Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCR9 cdna clone

CCR9 cDNA Clone

Gene Names
CCR9; GPR28; CDw199; GPR-9-6; CC-CKR-9
Synonyms
CCR9; CCR9 cDNA Clone; CCR9 cdna clone
Ordering
For Research Use Only!
Sequence
atgacacccacagacttcacaagccctattcctaacatggctgatgactatggctctgaatccacatcttccatggaagactacgttaacttcaacttcactgacttctactgtgagaaaaacaatgtcaggcagtttgcgagccatttcctcccacccttgtactggctcgtgttcatcgtgggtgccttgggcaacagtcttgttatccttgtctactggtactgcacaagagtgaagaccatgaccgacatgttccttttgaatttggcaattgctgacctcctctttcttgtcactcttcccttctgggccattgctgctgctgaccagtggaagttccagaccttcatgtgcaaggtggtcaacagcatgtacaagatgaacttctacagctgtgtgttgctgatcatgtgcatcagcgtggacaggtacattgccattgcccaggccatgagagcacatacttggagggagaaaaggcttttgtacagcaaaatggtttgctttaccatctgggtattggcagctgctctctgcatcccagaaatcttatacagccaaatcaaggaggaatccggcattgctatctgcaccatggtttaccctagcgatgagagcaccaaactgaagtcagctgtcttgaccctgaaggtcattctggggttcttccttcccttcgtggtcatggcttgctgctataccatcatcattcacaccctgatacaagccaagaagtcttccaagcacaaagccctaaaagtgaccatcactgtcctgaccgtctttgtcttgtctcagtttccctacaactgcattttgttggtgcagaccattgacgcctatgccatgttcatctccaactgtgccgtttccaccaacattgacatctgcttccaggtcacccagaccatcgccttcttccacagttgcctgaaccctgttctctatgtttttgtgggtgagagattccgccgggatctcgtgaaaaccctgaagaacttgggttgcatcagccaggcccagtgggtttcatttacaaggagagagggaagcttgaagctgtcgtctatgttgctggagacaacctcaggagcactctccctctga
Sequence Length
1110
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,713 Da
NCBI Official Full Name
Homo sapiens chemokine (C-C motif) receptor 9, mRNA
NCBI Official Synonym Full Names
C-C motif chemokine receptor 9
NCBI Official Symbol
CCR9
NCBI Official Synonym Symbols
GPR28; CDw199; GPR-9-6; CC-CKR-9
NCBI Protein Information
C-C chemokine receptor type 9
UniProt Protein Name
C-C chemokine receptor type 9
Protein Family
UniProt Gene Name
CCR9
UniProt Synonym Gene Names
GPR28; C-C CKR-9; CC-CKR-9; CCR-9
UniProt Entry Name
CCR9_HUMAN

NCBI Description

The protein encoded by this gene is a member of the beta chemokine receptor family. It is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. Chemokines and their receptors are key regulators of the thymocytes migration and maturation in normal and inflammation conditions. The specific ligand of this receptor is CCL25. It has been found that this gene is differentially expressed by T lymphocytes of small intestine and colon, suggested a role in the thymocytes recruitment and development that may permit functional specialization of immune responses in different segment of the gastrointestinal tract. This gene is mapped to the chemokine receptor gene cluster region. Two alternatively spliced transcript variants have been described. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]

Uniprot Description

CCR9: Receptor for chemokine SCYA25/TECK. Subsequently transduces a signal by increasing the intracellular calcium ions level. Alternative coreceptor with CD4 for HIV-1 infection. Belongs to the G-protein coupled receptor 1 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; GPCR, family 1; Membrane protein, integral; Motility/polarity/chemotaxis; Receptor, GPCR

Chromosomal Location of Human Ortholog: 3p21.3

Cellular Component: cell surface; integral to plasma membrane; plasma membrane

Molecular Function: chemokine receptor activity

Biological Process: cellular defense response; elevation of cytosolic calcium ion concentration

Research Articles on CCR9

Similar Products

Product Notes

The CCR9 ccr9 (Catalog #AAA1275980) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacaccca cagacttcac aagccctatt cctaacatgg ctgatgacta tggctctgaa tccacatctt ccatggaaga ctacgttaac ttcaacttca ctgacttcta ctgtgagaaa aacaatgtca ggcagtttgc gagccatttc ctcccaccct tgtactggct cgtgttcatc gtgggtgcct tgggcaacag tcttgttatc cttgtctact ggtactgcac aagagtgaag accatgaccg acatgttcct tttgaatttg gcaattgctg acctcctctt tcttgtcact cttcccttct gggccattgc tgctgctgac cagtggaagt tccagacctt catgtgcaag gtggtcaaca gcatgtacaa gatgaacttc tacagctgtg tgttgctgat catgtgcatc agcgtggaca ggtacattgc cattgcccag gccatgagag cacatacttg gagggagaaa aggcttttgt acagcaaaat ggtttgcttt accatctggg tattggcagc tgctctctgc atcccagaaa tcttatacag ccaaatcaag gaggaatccg gcattgctat ctgcaccatg gtttacccta gcgatgagag caccaaactg aagtcagctg tcttgaccct gaaggtcatt ctggggttct tccttccctt cgtggtcatg gcttgctgct ataccatcat cattcacacc ctgatacaag ccaagaagtc ttccaagcac aaagccctaa aagtgaccat cactgtcctg accgtctttg tcttgtctca gtttccctac aactgcattt tgttggtgca gaccattgac gcctatgcca tgttcatctc caactgtgcc gtttccacca acattgacat ctgcttccag gtcacccaga ccatcgcctt cttccacagt tgcctgaacc ctgttctcta tgtttttgtg ggtgagagat tccgccggga tctcgtgaaa accctgaaga acttgggttg catcagccag gcccagtggg tttcatttac aaggagagag ggaagcttga agctgtcgtc tatgttgctg gagacaacct caggagcact ctccctctga. It is sometimes possible for the material contained within the vial of "CCR9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.