Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCR4 cdna clone

CCR4 cDNA Clone

Gene Names
CCR4; CKR4; K5-5; CD194; CMKBR4; ChemR13; CC-CKR-4; HGCN:14099
Synonyms
CCR4; CCR4 cDNA Clone; CCR4 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaccccacggatatagcagacaccaccctcgatgaaagcatatacagcaattactatctgtatgaaagtatccccaagccttgcaccaaagaaggcatcaaggcatttggggagctcttcctgcccccactgtattccttggtttttgtatttggtctgcttggaaattctgtggtggttctggtcctgttcaaatacaagcggctcaggtccatgactgatgtgtacctgctcaaccttgccatctcggatctgctcttcgtgttttccctccctttttggggctactatgcagcagaccagtgggtttttgggctaggtctgtgcaagatgatttcctggatgtacttggtgggcttttacagtggcatattctttgtcatgctcatgagcattgatagatacctggcaattgtgcacgcggtgttttccttgagggcaaggaccttgacttatggggtcatcaccagtttggctacatggtcagtggctgtgttcgcctcccttcctggctttctgttcagcacttgttatactgagcgcaaccatacctactgcaaaaccaagtactctctcaactccacgacgtggaaggttctcagctccctggaaatcaacattctcggattggtgatccccttagggatcatgctgttttgctactccatgatcatcaggaccttgcagcattgtaaaaatgagaagaagaacaaggcggtgaagatgatctttgccgtggtggtcctcttccttgggttctggacaccttacaacatagtgctcttcctagagaccctggtggagctagaagtccttcaggactgcacctttgaaagatacttggactatgccatccaggccacagaaactctggcttttgttcactgctgccttaatcccatcatctacttttttctgggggagaaatttcgcaagtacatcctacagctcttcaaaacctgcaggggcctttttgtgctctgccaatactgtgggctcctccaaatttactctgctgacacccccagctcatcttacacgcagtccaccatggatcatgatctccatgatgctctgtag
Sequence Length
1083
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,403 Da
NCBI Official Full Name
Homo sapiens chemokine (C-C motif) receptor 4, mRNA
NCBI Official Synonym Full Names
C-C motif chemokine receptor 4
NCBI Official Symbol
CCR4
NCBI Official Synonym Symbols
CKR4; K5-5; CD194; CMKBR4; ChemR13; CC-CKR-4; HGCN:14099
NCBI Protein Information
C-C chemokine receptor type 4
UniProt Protein Name
C-C chemokine receptor type 4
Protein Family
UniProt Gene Name
CCR4
UniProt Synonym Gene Names
CMKBR4; C-C CKR-4; CC-CKR-4; CCR-4; CCR4
UniProt Entry Name
CCR4_HUMAN

NCBI Description

The protein encoded by this gene belongs to the G-protein-coupled receptor family . It is a receptor for the CC chemokine - MIP-1, RANTES, TARC and MCP-1. Chemokines are a group of small polypeptide, structurally related molecules that regulate cell trafficking of various types of leukocytes. The chemokines also play fundamental roles in the development, homeostasis, and function of the immune system, and they have effects on cells of the central nervous system as well as on endothelial cells involved in angiogenesis or angiostasis. [provided by RefSeq, Jul 2008]

Uniprot Description

CCR4: High affinity receptor for the C-C type chemokines CCL17/TARC and CCL22/MDC. The activity of this receptor is mediated by G(i) proteins which activate a phosphatidylinositol- calcium second messenger system. Can function as a chemoattractant homing receptor on circulating memory lymphocytes and as a coreceptor for some primary HIV-2 isolates. In the CNS, could mediate hippocampal-neuron survival. Belongs to the G-protein coupled receptor 1 family.

Protein type: Membrane protein, integral; Receptor, GPCR; Membrane protein, multi-pass; Motility/polarity/chemotaxis; GPCR, family 1

Chromosomal Location of Human Ortholog: 3p24

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: chemokine receptor activity

Biological Process: elevation of cytosolic calcium ion concentration

Research Articles on CCR4

Similar Products

Product Notes

The CCR4 ccr4 (Catalog #AAA1273598) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacccca cggatatagc agacaccacc ctcgatgaaa gcatatacag caattactat ctgtatgaaa gtatccccaa gccttgcacc aaagaaggca tcaaggcatt tggggagctc ttcctgcccc cactgtattc cttggttttt gtatttggtc tgcttggaaa ttctgtggtg gttctggtcc tgttcaaata caagcggctc aggtccatga ctgatgtgta cctgctcaac cttgccatct cggatctgct cttcgtgttt tccctccctt tttggggcta ctatgcagca gaccagtggg tttttgggct aggtctgtgc aagatgattt cctggatgta cttggtgggc ttttacagtg gcatattctt tgtcatgctc atgagcattg atagatacct ggcaattgtg cacgcggtgt tttccttgag ggcaaggacc ttgacttatg gggtcatcac cagtttggct acatggtcag tggctgtgtt cgcctccctt cctggctttc tgttcagcac ttgttatact gagcgcaacc atacctactg caaaaccaag tactctctca actccacgac gtggaaggtt ctcagctccc tggaaatcaa cattctcgga ttggtgatcc ccttagggat catgctgttt tgctactcca tgatcatcag gaccttgcag cattgtaaaa atgagaagaa gaacaaggcg gtgaagatga tctttgccgt ggtggtcctc ttccttgggt tctggacacc ttacaacata gtgctcttcc tagagaccct ggtggagcta gaagtccttc aggactgcac ctttgaaaga tacttggact atgccatcca ggccacagaa actctggctt ttgttcactg ctgccttaat cccatcatct acttttttct gggggagaaa tttcgcaagt acatcctaca gctcttcaaa acctgcaggg gcctttttgt gctctgccaa tactgtgggc tcctccaaat ttactctgct gacaccccca gctcatctta cacgcagtcc accatggatc atgatctcca tgatgctctg tag. It is sometimes possible for the material contained within the vial of "CCR4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.