Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCR1 cdna clone

CCR1 cDNA Clone

Gene Names
CCR1; CKR1; CD191; CKR-1; HM145; CMKBR1; MIP1aR; SCYAR1
Synonyms
CCR1; CCR1 cDNA Clone; CCR1 cdna clone
Ordering
For Research Use Only!
Sequence
atggaaactccaaacaccacagaggactatgacacgaccacagagtttgactatggggatgcaactccgtgccagaaggtgaacgagagggcctttggggcccaactgctgccccctctgtactccttggtatttgtcattggcctggttggaaacatcctggtggtcctggtccttgtgcaatacaagaggctaaaaaacatgaccagcatctacctcctgaacctggccatttctgacctgctcttcctgttcacgcttcccttctggatcgactacaagttgaaggatgactgggtttttggtgatgccatgtgtaagatcctctctgggttttattacacaggcttgtacagcgagatctttttcatcatcctgctgacgattgacaggtacctggccatcgtccacgccgtgtttgccttgcgggcacggaccgtcacttttggtgtcatcaccagcatcatcatttgggccctggccatcttggcttccatgccaggcttatacttttccaagacccaatgggaattcactcaccacacctgcagccttcactttcctcacgaaagcctacgagagtggaagctgtttcaggctctgaaactgaacctctttgggctggtattgcctttgttggtcatgatcatctgctacacagggattataaagattctgctaagacgaccaaatgagaagaaatccaaagctgtccgtttgatttttgtcatcatgatcatcttttttctcttttggaccccctacaatttgactatacttatttctgttttccaagacttcctgttcacccatgagtgtgagcagagcagacatttggacctggctgtgcaagtgacggaggtgatcgcctacacgcactgctgtgtcaacccagtgatctacgccttcgttggtgagaggttccggaagtacctgcggcagttgttccacaggcgtgtggctgtgcacctggttaaatggctccccttcctctccgtggacaggctggagagggtcagctccacatctccctccacaggggagcatgaactctctgctgggttctga
Sequence Length
1068
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,173 Da
NCBI Official Full Name
Homo sapiens chemokine (C-C motif) receptor 1, mRNA
NCBI Official Synonym Full Names
C-C motif chemokine receptor 1
NCBI Official Symbol
CCR1
NCBI Official Synonym Symbols
CKR1; CD191; CKR-1; HM145; CMKBR1; MIP1aR; SCYAR1
NCBI Protein Information
C-C chemokine receptor type 1
UniProt Protein Name
C-C chemokine receptor type 1
Protein Family
UniProt Gene Name
CCR1
UniProt Synonym Gene Names
CMKBR1; CMKR1; SCYAR1; C-C CKR-1; CC-CKR-1; CCR-1; CCR1; MIP-1alpha-R
UniProt Entry Name
CCR1_HUMAN

NCBI Description

This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. The ligands of this receptor include macrophage inflammatory protein 1 alpha (MIP-1 alpha), regulated on activation normal T expressed and secreted protein (RANTES), monocyte chemoattractant protein 3 (MCP-3), and myeloid progenitor inhibitory factor-1 (MPIF-1). Chemokines and their receptors mediated signal transduction are critical for the recruitment of effector immune cells to the site of inflammation. Knockout studies of the mouse homolog suggested the roles of this gene in host protection from inflammatory response, and susceptibility to virus and parasite. This gene and other chemokine receptor genes, including CCR2, CCRL2, CCR3, CCR5 and CCXCR1, are found to form a gene cluster on chromosome 3p. [provided by RefSeq, Jul 2008]

Uniprot Description

CCR1: Receptor for a C-C type chemokine. Binds to MIP-1-alpha, MIP-1-delta, RANTES, and MCP-3 and, less efficiently, to MIP-1- beta or MCP-1 and subsequently transduces a signal by increasing the intracellular calcium ions level. Responsible for affecting stem cell proliferation. Belongs to the G-protein coupled receptor 1 family.

Protein type: Membrane protein, multi-pass; Receptor, GPCR; GPCR, family 1; Membrane protein, integral; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 3p21

Cellular Component: external side of plasma membrane; integral to plasma membrane; plasma membrane

Molecular Function: C-C chemokine binding; C-C chemokine receptor activity; chemokine receptor activity; phosphoinositide phospholipase C activity; protein binding

Biological Process: calcium ion transport; cell adhesion; cell surface receptor linked signal transduction; cell-cell signaling; cellular calcium ion homeostasis; dendritic cell chemotaxis; elevation of cytosolic calcium ion concentration; exocytosis; G-protein signaling, coupled to cyclic nucleotide second messenger; immune response; negative regulation of bone mineralization; positive regulation of calcium ion transport; positive regulation of cell migration; positive regulation of osteoclast differentiation; response to wounding

Research Articles on CCR1

Similar Products

Product Notes

The CCR1 ccr1 (Catalog #AAA1273235) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaactc caaacaccac agaggactat gacacgacca cagagtttga ctatggggat gcaactccgt gccagaaggt gaacgagagg gcctttgggg cccaactgct gccccctctg tactccttgg tatttgtcat tggcctggtt ggaaacatcc tggtggtcct ggtccttgtg caatacaaga ggctaaaaaa catgaccagc atctacctcc tgaacctggc catttctgac ctgctcttcc tgttcacgct tcccttctgg atcgactaca agttgaagga tgactgggtt tttggtgatg ccatgtgtaa gatcctctct gggttttatt acacaggctt gtacagcgag atctttttca tcatcctgct gacgattgac aggtacctgg ccatcgtcca cgccgtgttt gccttgcggg cacggaccgt cacttttggt gtcatcacca gcatcatcat ttgggccctg gccatcttgg cttccatgcc aggcttatac ttttccaaga cccaatggga attcactcac cacacctgca gccttcactt tcctcacgaa agcctacgag agtggaagct gtttcaggct ctgaaactga acctctttgg gctggtattg cctttgttgg tcatgatcat ctgctacaca gggattataa agattctgct aagacgacca aatgagaaga aatccaaagc tgtccgtttg atttttgtca tcatgatcat cttttttctc ttttggaccc cctacaattt gactatactt atttctgttt tccaagactt cctgttcacc catgagtgtg agcagagcag acatttggac ctggctgtgc aagtgacgga ggtgatcgcc tacacgcact gctgtgtcaa cccagtgatc tacgccttcg ttggtgagag gttccggaag tacctgcggc agttgttcca caggcgtgtg gctgtgcacc tggttaaatg gctccccttc ctctccgtgg acaggctgga gagggtcagc tccacatctc cctccacagg ggagcatgaa ctctctgctg ggttctga. It is sometimes possible for the material contained within the vial of "CCR1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.