Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCNI2 cdna clone

CCNI2 cDNA Clone

Synonyms
CCNI2; CCNI2 cDNA Clone; CCNI2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcctcgggcgctcagctcccgccgcagccgtcgagctcagaggtcagcgccgtccagagcccaggcgggcgtcccggcgccggtctggaggaaacagccctgggcgttcctctcccgccgtctccgggggaggcccctctgccccgaagcaaccggagcaggtgccctgggacccgccagcccggagcggcctccctccacgcggcgtccgcagcagtccccgtgcggccccggcgcggtacggcgccagccgggaaaaccgcagacgcggtccccgccgccgccccagagcaagctccgcggccggctccacagtcccgcaagccgcgcaacctggaaggcgacctggacgagcgccggctgctctgccacttgcagctggcccaggaccgcgaggcgcgcctgtggcggggcggcaaaccccaggatgaaatctgcgacgccttcgaggaagtcgtgctgtggctcctgcggcttcagaacaccttttacttctcccagtccacttttaacctggccctcaccatctttggccgcctcctgatttcagtgaaggtaaaagagaaatacctgcattgcgccacaattacttccttgaggctcgctgcaaaagttaatgaagaagaggagtttattccacaagtaaaagacttcacaaagcactatggctctgactattccccgaatgagctgctgaggatggagctggctattctggacagactgcactgggacctctatattgggacgccgctggacttcttgactatattccatgccctggtggtcctgagctggccccatgtgttggagctgctgcctcagaggaatccttccctccacgtcgcatccctgaccaggcagctgcagcactgtatggcgggccaccagctgctgcagttcaagggctccacactggccttggtcatcatcaccttagagctggagaggctcatgcccggctggtgtgctcctatatctgatctgctaaagaaagcacaggttggtgatatgcagtacagctgctgcaaggaacttgtaatgcagcaactgagaagtcttcagtcatcctcctgcacagacaactttgtgtcacctgccaactag
Sequence Length
1110
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,750 Da
NCBI Official Full Name
Homo sapiens cyclin I family, member 2, mRNA
NCBI Official Synonym Full Names
cyclin I family member 2
NCBI Official Symbol
CCNI2
NCBI Protein Information
cyclin-I2
UniProt Protein Name
Cyclin-I2
Protein Family
UniProt Gene Name
CCNI2
UniProt Entry Name
CCNI2_HUMAN

Uniprot Description

CCNI2: Belongs to the cyclin family.

Protein type: Cell cycle regulation

Chromosomal Location of Human Ortholog: 5q31.1

Similar Products

Product Notes

The CCNI2 ccni2 (Catalog #AAA1274398) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcctcgg gcgctcagct cccgccgcag ccgtcgagct cagaggtcag cgccgtccag agcccaggcg ggcgtcccgg cgccggtctg gaggaaacag ccctgggcgt tcctctcccg ccgtctccgg gggaggcccc tctgccccga agcaaccgga gcaggtgccc tgggacccgc cagcccggag cggcctccct ccacgcggcg tccgcagcag tccccgtgcg gccccggcgc ggtacggcgc cagccgggaa aaccgcagac gcggtccccg ccgccgcccc agagcaagct ccgcggccgg ctccacagtc ccgcaagccg cgcaacctgg aaggcgacct ggacgagcgc cggctgctct gccacttgca gctggcccag gaccgcgagg cgcgcctgtg gcggggcggc aaaccccagg atgaaatctg cgacgccttc gaggaagtcg tgctgtggct cctgcggctt cagaacacct tttacttctc ccagtccact tttaacctgg ccctcaccat ctttggccgc ctcctgattt cagtgaaggt aaaagagaaa tacctgcatt gcgccacaat tacttccttg aggctcgctg caaaagttaa tgaagaagag gagtttattc cacaagtaaa agacttcaca aagcactatg gctctgacta ttccccgaat gagctgctga ggatggagct ggctattctg gacagactgc actgggacct ctatattggg acgccgctgg acttcttgac tatattccat gccctggtgg tcctgagctg gccccatgtg ttggagctgc tgcctcagag gaatccttcc ctccacgtcg catccctgac caggcagctg cagcactgta tggcgggcca ccagctgctg cagttcaagg gctccacact ggccttggtc atcatcacct tagagctgga gaggctcatg cccggctggt gtgctcctat atctgatctg ctaaagaaag cacaggttgg tgatatgcag tacagctgct gcaaggaact tgtaatgcag caactgagaa gtcttcagtc atcctcctgc acagacaact ttgtgtcacc tgccaactag. It is sometimes possible for the material contained within the vial of "CCNI2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.