Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCNI cdna clone

CCNI cDNA Clone

Gene Names
CCNI; CYI; CYC1; CCNI1
Synonyms
CCNI; CCNI cDNA Clone; CCNI cdna clone
Ordering
For Research Use Only!
Sequence
atgaagtttccagggcctttggaaaaccagagattgtctttcctgttggaaaaggcaatcactagggaagcacagatgtggaaagtgaatgtgcggaaaatgccttcaaatcagaatgtttctccatcccagagagatgaagtaattcaatggctggccaaactcaagtaccaattcaacctttacccagaaacatttgctctggctagcagtcttttggataggtttttagctaccgtaaaggctcatccaaaatacttgagttgtattgcaatcagctgttttttcctagctgccaagactgttgaggaagatgagagaattccagtactaaaggtattggcaagagacagtttctgtggatgttcctcatctgaaattttgagaatggagagaattattctggataagttgaattgggatcttcacacagccacaccattggattttcttcatattttccatgccattgcagtgtcaactaggcctcagttacttttcagtttgcccaaattgagcccatctcaacatttggcagtccttaccaagcaactacttcactgtatggcctgcaaccaacttctgcaattcagaggatccatgcttgctctggccatggttagtctggaaatggagaaactcattcctgattggctttctcttacaattgaactgcttcagaaagcacagatggatagctcccagttgatccattgtcgggagcttgtggcacatcacctttctactctgcagtcttccctgcctctgaattccgtttatgtctaccgtcccctcaagcacaccctggtgacctgtgacaaaggagtgttcagattacatccctcctctgtcccaggcccagacttctccaaggacaacagcaagccagaagtgccagtcagaggtacagcagccttttaccatcatctcccagctgccagtgggtgcaagcagacctctactaaacgcaaagtagaggaaatggaagtggatgacttctatgatggaatcaaacggctctataatgaagataatgtctcagaaaatgtgggttctgtgtgtggcactgatttatcaagacaagagggacatgcttccccttgtccacctttgcagcctgtttctgtcatgtag
Sequence Length
1134
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,877 Da
NCBI Official Full Name
Homo sapiens cyclin I, mRNA
NCBI Official Synonym Full Names
cyclin I
NCBI Official Symbol
CCNI
NCBI Official Synonym Symbols
CYI; CYC1; CCNI1
NCBI Protein Information
cyclin-I
UniProt Protein Name
Cyclin-I
Protein Family
UniProt Gene Name
CCNI
UniProt Entry Name
CCNI_HUMAN

NCBI Description

The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin shows the highest similarity with cyclin G. The transcript of this gene was found to be expressed constantly during cell cycle progression. The function of this cyclin has not yet been determined. [provided by RefSeq, Jul 2008]

Uniprot Description

CCNI: belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin shows the highest similarity with cyclin G. The transcript of this gene was found to be expressed constantly during cell cycle progression. The function of this cyclin has not yet been determined. [provided by RefSeq, Jul 2008]

Protein type: Cell cycle regulation

Chromosomal Location of Human Ortholog: 4q21.1

Research Articles on CCNI

Similar Products

Product Notes

The CCNI ccni (Catalog #AAA1270681) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagtttc cagggccttt ggaaaaccag agattgtctt tcctgttgga aaaggcaatc actagggaag cacagatgtg gaaagtgaat gtgcggaaaa tgccttcaaa tcagaatgtt tctccatccc agagagatga agtaattcaa tggctggcca aactcaagta ccaattcaac ctttacccag aaacatttgc tctggctagc agtcttttgg ataggttttt agctaccgta aaggctcatc caaaatactt gagttgtatt gcaatcagct gttttttcct agctgccaag actgttgagg aagatgagag aattccagta ctaaaggtat tggcaagaga cagtttctgt ggatgttcct catctgaaat tttgagaatg gagagaatta ttctggataa gttgaattgg gatcttcaca cagccacacc attggatttt cttcatattt tccatgccat tgcagtgtca actaggcctc agttactttt cagtttgccc aaattgagcc catctcaaca tttggcagtc cttaccaagc aactacttca ctgtatggcc tgcaaccaac ttctgcaatt cagaggatcc atgcttgctc tggccatggt tagtctggaa atggagaaac tcattcctga ttggctttct cttacaattg aactgcttca gaaagcacag atggatagct cccagttgat ccattgtcgg gagcttgtgg cacatcacct ttctactctg cagtcttccc tgcctctgaa ttccgtttat gtctaccgtc ccctcaagca caccctggtg acctgtgaca aaggagtgtt cagattacat ccctcctctg tcccaggccc agacttctcc aaggacaaca gcaagccaga agtgccagtc agaggtacag cagcctttta ccatcatctc ccagctgcca gtgggtgcaa gcagacctct actaaacgca aagtagagga aatggaagtg gatgacttct atgatggaat caaacggctc tataatgaag ataatgtctc agaaaatgtg ggttctgtgt gtggcactga tttatcaaga caagagggac atgcttcccc ttgtccacct ttgcagcctg tttctgtcat gtag. It is sometimes possible for the material contained within the vial of "CCNI, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.