Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCNE1 cdna clone

CCNE1 cDNA Clone

Gene Names
CCNE1; CCNE; pCCNE1
Synonyms
CCNE1; CCNE1 cDNA Clone; CCNE1 cdna clone
Ordering
For Research Use Only!
Sequence
atgccgagggagcgcagggagcgggatgcgaaggagcgggacaccatgaaggaggacggcggcgcggagttctcggctcgctccaggaagaggaaggcaaacgtgaccgtttttttgcaggatccagatgaagaaatggccaaaatcgacaggacggcgagggaccagtgtgggagccagccttgggacaataatgcagtctgtgcagacccctgctccctgatccccacacctgacaaagaagatgatgaccgggtttacccaaactcaacgtgcaagcctcggattattgcaccatccagaggctccccgctgcctgtactgagctgggcaaatagagaggaagtctggaaaatcatgttaaacaaggaaaagacatacttaagggatcagcactttcttgagcaacaccctcttctgcagccaaaaatgcgagcaattcttctggattggttaatggaggtgtgtgaagtctataaacttcacagggagaccttttacttggcacaagatttctttgaccggtatatggcgacacaagaaaatgttgtaaaaactcttttacagcttattgggatttcatctttatttattgcagccaaacttgaggaaatctatcctccaaagttgcaccagtttgcgtatgtgacagatggagcttgttcaggagatgaaattctcaccatggaattaatgattatgaaggcccttaagtggcgtttaagtcccctgactattgtgtcctggctgaatgtatacatgcaggttgcatatctaaatgacttacatgaagtgctactgccgcagtatccccagcaaatctttatacagattgcagagctgttggatctctgtgtcctggatgttgactgccttgaatttccttatggtatacttgctgcttcggccttgtatcatttctcgtcatctgaattgatgcaaaaggtttcagggtatcagtggtgcgacatagagaactgtgtcaagtggatggttccatttgccatggttataagggagacggggagctcaaaactgaagcacttcaggggcgtcgctgatgaagatgcacacaacatacagacccacagagacagcttggatttgctggacaaagcccgagcaaagaaagccatgttgtctgaacaaaatagggcttctcctctccccagtgggctcctcaccccgccacagagcggtaagaagcagagcagcgggccggaaatggcgtga
Sequence Length
1233
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
898
Molecular Weight
45,150 Da
NCBI Official Full Name
Homo sapiens cyclin E1, mRNA
NCBI Official Synonym Full Names
cyclin E1
NCBI Official Symbol
CCNE1
NCBI Official Synonym Symbols
CCNE; pCCNE1
NCBI Protein Information
G1/S-specific cyclin-E1
UniProt Protein Name
G1/S-specific cyclin-E1
UniProt Gene Name
CCNE1
UniProt Synonym Gene Names
CCNE
UniProt Entry Name
CCNE1_HUMAN

NCBI Description

The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK2, whose activity is required for cell cycle G1/S transition. This protein accumulates at the G1-S phase boundary and is degraded as cells progress through S phase. Overexpression of this gene has been observed in many tumors, which results in chromosome instability, and thus may contribute to tumorigenesis. This protein was found to associate with, and be involved in, the phosphorylation of NPAT protein (nuclear protein mapped to the ATM locus), which participates in cell-cycle regulated histone gene expression and plays a critical role in promoting cell-cycle progression in the absence of pRB. [provided by RefSeq, Apr 2016]

Uniprot Description

CCNE1: a member of the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Forms a complex with and functions as a regulatory subunit of CDK2, whose activity is required for cell cycle G1/S transition. Accumulates at the G1-S phase boundary and is degraded as cells progress through S phase. Two alternatively spliced isoforms have been described.

Protein type: Nuclear receptor co-regulator; Activator; Cell cycle regulation

Chromosomal Location of Human Ortholog: 19q12

Cellular Component: cytosol; nucleoplasm; nucleus

Molecular Function: protein binding

Biological Process: G1/S transition of mitotic cell cycle; G1/S-specific transcription in mitotic cell cycle; protein amino acid phosphorylation

Research Articles on CCNE1

Similar Products

Product Notes

The CCNE1 ccne1 (Catalog #AAA1276836) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgaggg agcgcaggga gcgggatgcg aaggagcggg acaccatgaa ggaggacggc ggcgcggagt tctcggctcg ctccaggaag aggaaggcaa acgtgaccgt ttttttgcag gatccagatg aagaaatggc caaaatcgac aggacggcga gggaccagtg tgggagccag ccttgggaca ataatgcagt ctgtgcagac ccctgctccc tgatccccac acctgacaaa gaagatgatg accgggttta cccaaactca acgtgcaagc ctcggattat tgcaccatcc agaggctccc cgctgcctgt actgagctgg gcaaatagag aggaagtctg gaaaatcatg ttaaacaagg aaaagacata cttaagggat cagcactttc ttgagcaaca ccctcttctg cagccaaaaa tgcgagcaat tcttctggat tggttaatgg aggtgtgtga agtctataaa cttcacaggg agacctttta cttggcacaa gatttctttg accggtatat ggcgacacaa gaaaatgttg taaaaactct tttacagctt attgggattt catctttatt tattgcagcc aaacttgagg aaatctatcc tccaaagttg caccagtttg cgtatgtgac agatggagct tgttcaggag atgaaattct caccatggaa ttaatgatta tgaaggccct taagtggcgt ttaagtcccc tgactattgt gtcctggctg aatgtataca tgcaggttgc atatctaaat gacttacatg aagtgctact gccgcagtat ccccagcaaa tctttataca gattgcagag ctgttggatc tctgtgtcct ggatgttgac tgccttgaat ttccttatgg tatacttgct gcttcggcct tgtatcattt ctcgtcatct gaattgatgc aaaaggtttc agggtatcag tggtgcgaca tagagaactg tgtcaagtgg atggttccat ttgccatggt tataagggag acggggagct caaaactgaa gcacttcagg ggcgtcgctg atgaagatgc acacaacata cagacccaca gagacagctt ggatttgctg gacaaagccc gagcaaagaa agccatgttg tctgaacaaa atagggcttc tcctctcccc agtgggctcc tcaccccgcc acagagcggt aagaagcaga gcagcgggcc ggaaatggcg tga. It is sometimes possible for the material contained within the vial of "CCNE1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.