Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCNDBP1 cdna clone

CCNDBP1 cDNA Clone

Gene Names
CCNDBP1; HHM; DIP1; GCIP
Synonyms
CCNDBP1; CCNDBP1 cDNA Clone; CCNDBP1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgagcgcaactgcacctgcagccgcagtccccaccctggcttcgcctttggagcagctccggcacttggcggaggagctgcggttgctcctgcctcgagtgcgggtcggcgaagcccaggagaccaccgaggagtttaatcgagagatgttctggagaagactcaatgaggcagctgtgactgtgtcaagggaagccacgactctgaccatagtcttctctcagcttccactgccgtctccacaggaaacccagaagttctgtgaacaagtccatgctgccatcaaggcatttattgcagtgtactatttgcttccaaaggatcaggggatcaccctgagaaagctggtacggggcgccaccctggacatcgtggatggcatggctcagctcatggaagtactttccgtcactccaactcagagccctgagaacaatgaccttatttcctacaacagtgtctgggttgcgtgccagcagatgcctcagataccaagagataacaaagctgcagctcttttgatgctgaccaagaatgtggattttgtgaaggatgcacatgaagaaatggagcaggctgtggaagaatgtgacccttactctggcctcttgaatgatactgaggagaacaactctgacaaccacaatcatgaggatgatgtgttggggtttcccagcaatcaggacttgtattggtcagaggacgatcaagagctcataatcccatgccttgcgctggtgagagcatccaaagcctgcctgaagaaaattcggatgttagtggcagagaatgggaagaaggatcaggtggcacagctggatgacattgtggatatttctgatgaaatcagccctagtgtggatgatttggctctgagcatatatccacctatgtgtcacctgaccgtgcgaatcaattctgcgaaacttgtatctgttttaaagaaggcacttgaaattacaaaagcaagtcatgtgacccctcagccagaagatagttggatccctttacttattaatgccattgatcattgcatgaatagaatcaaggagctcactcagagtgaacttgaattatga
Sequence Length
1083
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,714 Da
NCBI Official Full Name
Homo sapiens cyclin D-type binding-protein 1, mRNA
NCBI Official Synonym Full Names
cyclin D1 binding protein 1
NCBI Official Symbol
CCNDBP1
NCBI Official Synonym Symbols
HHM; DIP1; GCIP
NCBI Protein Information
cyclin-D1-binding protein 1
UniProt Protein Name
Cyclin-D1-binding protein 1
Protein Family
UniProt Gene Name
CCNDBP1
UniProt Synonym Gene Names
DIP1; GCIP; HHM
UniProt Entry Name
CCDB1_HUMAN

NCBI Description

This gene was identified by the interaction of its gene product with Grap2, a leukocyte-specific adaptor protein important for immune cell signaling. The protein encoded by this gene was shown to interact with cyclin D. Transfection of this gene in cells was reported to reduce the phosphorylation of Rb gene product by cyclin D-dependent protein kinase, and inhibit E2F1-mediated transcription activity. This protein was also found to interact with helix-loop-helix protein E12 and is thought to be a negative regulator of liver-specific gene expression. Several alternatively spliced variants have been found for this gene. [provided by RefSeq, Apr 2009]

Uniprot Description

CCNDBP1: May negatively regulate cell cycle progression. May act at least in part via inhibition of the cyclin-D1/CDK4 complex, thereby preventing phosphorylation of RB1 and blocking E2F- dependent transcription. Belongs to the CCNDBP1 family. 4 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 15q14-q15

Cellular Component: nucleoplasm; nucleus

Molecular Function: protein binding

Research Articles on CCNDBP1

Similar Products

Product Notes

The CCNDBP1 ccndbp1 (Catalog #AAA1271430) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgagcg caactgcacc tgcagccgca gtccccaccc tggcttcgcc tttggagcag ctccggcact tggcggagga gctgcggttg ctcctgcctc gagtgcgggt cggcgaagcc caggagacca ccgaggagtt taatcgagag atgttctgga gaagactcaa tgaggcagct gtgactgtgt caagggaagc cacgactctg accatagtct tctctcagct tccactgccg tctccacagg aaacccagaa gttctgtgaa caagtccatg ctgccatcaa ggcatttatt gcagtgtact atttgcttcc aaaggatcag gggatcaccc tgagaaagct ggtacggggc gccaccctgg acatcgtgga tggcatggct cagctcatgg aagtactttc cgtcactcca actcagagcc ctgagaacaa tgaccttatt tcctacaaca gtgtctgggt tgcgtgccag cagatgcctc agataccaag agataacaaa gctgcagctc ttttgatgct gaccaagaat gtggattttg tgaaggatgc acatgaagaa atggagcagg ctgtggaaga atgtgaccct tactctggcc tcttgaatga tactgaggag aacaactctg acaaccacaa tcatgaggat gatgtgttgg ggtttcccag caatcaggac ttgtattggt cagaggacga tcaagagctc ataatcccat gccttgcgct ggtgagagca tccaaagcct gcctgaagaa aattcggatg ttagtggcag agaatgggaa gaaggatcag gtggcacagc tggatgacat tgtggatatt tctgatgaaa tcagccctag tgtggatgat ttggctctga gcatatatcc acctatgtgt cacctgaccg tgcgaatcaa ttctgcgaaa cttgtatctg ttttaaagaa ggcacttgaa attacaaaag caagtcatgt gacccctcag ccagaagata gttggatccc tttacttatt aatgccattg atcattgcat gaatagaatc aaggagctca ctcagagtga acttgaatta tga. It is sometimes possible for the material contained within the vial of "CCNDBP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.