Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCND1 cdna clone

CCND1 cDNA Clone

Gene Names
CCND1; BCL1; PRAD1; U21B31; D11S287E
Synonyms
CCND1; CCND1 cDNA Clone; CCND1 cdna clone
Ordering
For Research Use Only!
Sequence
atggaacaccagctcctgtgctgcgaagtggaaaccatccgccgcgcgtaccccgatgccaacctcctcaacgaccgggtgctgcgggccatgctgaaggcggaggagacctgcgcgccctcggtgtcctacttcaaatgtgtgcagaaggaggtcctgccgtccatgcggaagatcgtcgccacctggatgctggaggtctgcgaggaacagaagtgcgaggaggaggtcttcccgctggccatgaactacctggaccgcttcctgtcgctggagcccgtgaaaaagagccgcctgcagctgctgggggccacttgcatgttcgtggcctctaagatgaaggagaccatccccctgacggccgagaagctgtgcatctacaccgacaactccatccggcccgaggagctgctgcaaatggagctgctcctggtgaacaagctcaagtggaacctggccgcaatgaccccgcacgatttcattgaacacttcctctccaaaatgccagaggcggaggagaacaaacagatcatccgcaaacacgcgcagaccttcgttgccctctgtgccacagatgtgaagttcatttccaatccgccctccatggtggcagcggggagcgtggtggccgcagtgcaaggcctgaacctgaggagccccaacaacttcctgtcctactaccgcctcacacgcttcctctccagagtgatcaagtgtgacccggactgcctccgggcctgccaggagcagatcgaagccctgctggagtcaagcctgcgccaggcccagcagaacatggaccccaaggccgccgaggaggaggaagaggaggaggaggaggtggacctggcttgcacacccaccgacgtgcgggacgtggacatctga
Sequence Length
888
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
595
Molecular Weight
33,729 Da
NCBI Official Full Name
Homo sapiens cyclin D1, mRNA
NCBI Official Synonym Full Names
cyclin D1
NCBI Official Symbol
CCND1
NCBI Official Synonym Symbols
BCL1; PRAD1; U21B31; D11S287E
NCBI Protein Information
G1/S-specific cyclin-D1
UniProt Protein Name
G1/S-specific cyclin-D1
Protein Family
UniProt Gene Name
CCND1
UniProt Synonym Gene Names
BCL1; PRAD1; BCL-1
UniProt Entry Name
CCND1_HUMAN

NCBI Description

The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance throughout the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK4 or CDK6, whose activity is required for cell cycle G1/S transition. This protein has been shown to interact with tumor suppressor protein Rb and the expression of this gene is regulated positively by Rb. Mutations, amplification and overexpression of this gene, which alters cell cycle progression, are observed frequently in a variety of tumors and may contribute to tumorigenesis. [provided by RefSeq, Jul 2008]

Uniprot Description

CCND1: a member of the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Forms a complex with and functions as a regulatory subunit of CDK4 or CDK6, whose activity is required for cell cycle G1/S transition. This protein has been shown to interact with tumor suppressor protein Rb and the expression of this gene is regulated positively by Rb.

Protein type: Cell cycle regulation; Oncoprotein; Nuclear receptor co-regulator; Activator

Chromosomal Location of Human Ortholog: 11q13

Cellular Component: cyclin-dependent protein kinase holoenzyme complex; cytosol; intracellular; nucleoplasm; nucleus; transcriptional repressor complex

Molecular Function: enzyme binding; histone deacetylase binding; protein binding; protein kinase binding; transcription corepressor activity; transcription factor binding

Biological Process: G1 DNA damage checkpoint; G1/S transition of mitotic cell cycle; negative regulation of transcription from RNA polymerase II promoter; positive regulation of cell cycle; positive regulation of cyclin-dependent protein kinase activity; positive regulation of protein amino acid phosphorylation; response to DNA damage stimulus; response to drug

Disease: Myeloma, Multiple; Von Hippel-lindau Syndrome

Research Articles on CCND1

Similar Products

Product Notes

The CCND1 ccnd1 (Catalog #AAA1274361) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaacacc agctcctgtg ctgcgaagtg gaaaccatcc gccgcgcgta ccccgatgcc aacctcctca acgaccgggt gctgcgggcc atgctgaagg cggaggagac ctgcgcgccc tcggtgtcct acttcaaatg tgtgcagaag gaggtcctgc cgtccatgcg gaagatcgtc gccacctgga tgctggaggt ctgcgaggaa cagaagtgcg aggaggaggt cttcccgctg gccatgaact acctggaccg cttcctgtcg ctggagcccg tgaaaaagag ccgcctgcag ctgctggggg ccacttgcat gttcgtggcc tctaagatga aggagaccat ccccctgacg gccgagaagc tgtgcatcta caccgacaac tccatccggc ccgaggagct gctgcaaatg gagctgctcc tggtgaacaa gctcaagtgg aacctggccg caatgacccc gcacgatttc attgaacact tcctctccaa aatgccagag gcggaggaga acaaacagat catccgcaaa cacgcgcaga ccttcgttgc cctctgtgcc acagatgtga agttcatttc caatccgccc tccatggtgg cagcggggag cgtggtggcc gcagtgcaag gcctgaacct gaggagcccc aacaacttcc tgtcctacta ccgcctcaca cgcttcctct ccagagtgat caagtgtgac ccggactgcc tccgggcctg ccaggagcag atcgaagccc tgctggagtc aagcctgcgc caggcccagc agaacatgga ccccaaggcc gccgaggagg aggaagagga ggaggaggag gtggacctgg cttgcacacc caccgacgtg cgggacgtgg acatctga. It is sometimes possible for the material contained within the vial of "CCND1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.