Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCDC56 cdna clone

CCDC56 cDNA Clone

Gene Names
COA3; COX25; CCDC56; HSPC009; MITRAC12
Synonyms
CCDC56; CCDC56 cDNA Clone; CCDC56 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgtcttcgggagctggtgaccctctggattctaagcgtggagaggccccgttcgctcagcgtatcgacccgactcgggagaagctgacacccgagcaactgcattccatgcggcaggcggagcttgcccagtggcagaaggtcctaccacggcggcgaacccggaacatcgtgaccggcctaggcatcggggccctggtgttggctatttatggttacaccttctactcgatttcccaggagcgtttcctagatgagctagaagacgaggccaaagctgcccgagcccgagctctggcaagggcgtcagggtcctaa
Sequence Length
321
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
11,731 Da
NCBI Official Full Name
Homo sapiens coiled-coil domain containing 56, mRNA
NCBI Official Synonym Full Names
cytochrome c oxidase assembly factor 3
NCBI Official Symbol
COA3
NCBI Official Synonym Symbols
COX25; CCDC56; HSPC009; MITRAC12
NCBI Protein Information
cytochrome c oxidase assembly factor 3 homolog, mitochondrial
UniProt Protein Name
Cytochrome c oxidase assembly factor 3 homolog, mitochondrial
UniProt Gene Name
COA3
UniProt Synonym Gene Names
CCDC56; MITRAC12
UniProt Entry Name
COA3_HUMAN

NCBI Description

This gene encodes a member of the cytochrome c oxidase assembly factor family. Studies of a related gene in fly suggest that the encoded protein is localized to mitochondria and is essential for cytochrome c oxidase function. [provided by RefSeq, Nov 2012]

Uniprot Description

CCDC56: Putative COX assembly factor. Belongs to the COA3 family.

Protein type: Mitochondrial; Membrane protein, integral

Chromosomal Location of Human Ortholog: 17q21

Cellular Component: integral to mitochondrial inner membrane; mitochondrion

Molecular Function: protein binding

Biological Process: mitochondrial respiratory chain complex IV assembly

Research Articles on CCDC56

Similar Products

Product Notes

The CCDC56 coa3 (Catalog #AAA1271184) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgtctt cgggagctgg tgaccctctg gattctaagc gtggagaggc cccgttcgct cagcgtatcg acccgactcg ggagaagctg acacccgagc aactgcattc catgcggcag gcggagcttg cccagtggca gaaggtccta ccacggcggc gaacccggaa catcgtgacc ggcctaggca tcggggccct ggtgttggct atttatggtt acaccttcta ctcgatttcc caggagcgtt tcctagatga gctagaagac gaggccaaag ctgcccgagc ccgagctctg gcaagggcgt cagggtccta a. It is sometimes possible for the material contained within the vial of "CCDC56, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.