Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCDC101 cdna clone

CCDC101 cDNA Clone

Gene Names
SGF29; STAF36; TDRD29; CCDC101
Synonyms
CCDC101; CCDC101 cDNA Clone; CCDC101 cdna clone
Ordering
For Research Use Only!
Sequence
atggccctcgtgtctgccgattcccgcattgcagaacttctcacagagctccatcagctgatcaaacaaacccaggaagagcgttcgcggagcgaacacaacttagtgaacatccagaagacccatgagcggatgcagacagagaacaagatttctccctattaccggacaaagctgcgtggcctctacacaaccgccaaggccgatgcagaggctgagtgcaacatccttcggaaagctctggacaagatcgcggaaatcaagtctctgttggaagagaggcggattgcggccaagattgccggtctctacaatgactcggagccaccccggaagaccatgcgcagaggggtgctgatgaccctgctgcagcagtcggccatgaccctgcccctgtggatcgggaagcctggtgacaagcccccacccctctgtggggccatccctgcctcaggagactacgtggccagacctggagacaaggtggctgcccgggtgaaggccgtggatggggacgagcagtggatcctggccgaggtggtcagttacagccatgccaccaacaagtatgaggtagatgacatcgatgaagaaggcaaagagagacacaccctgagccggcgccgtgtcatcccgctgccccagtggaaggccaacccggagacggaccctgaggccttgttccagaaggagcagctcgtgctggccctgtatccccagactacctgcttctaccgcgccctgatccatgcgcccccacagcggccccaggatgactactcggtcctgtttgaagacacctcctatgcagatggctattcccctcccctcaatgtggctcagagatacgtggtggcttgtaaggaacccaagaaaaagtga
Sequence Length
882
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,238 Da
NCBI Official Full Name
Homo sapiens coiled-coil domain containing 101, mRNA
NCBI Official Synonym Full Names
SAGA complex associated factor 29
NCBI Official Symbol
SGF29
NCBI Official Synonym Symbols
STAF36; TDRD29; CCDC101
NCBI Protein Information
SAGA-associated factor 29
UniProt Protein Name
SAGA-associated factor 29
UniProt Gene Name
SGF29
UniProt Entry Name
SGF29_HUMAN

NCBI Description

CCDC101 is a subunit of 2 histone acetyltransferase complexes: the ADA2A (TADA2A; MIM 602276)-containing (ATAC) complex and the SPT3 (SUPT3H; MIM 602947)-TAF9 (MIM 600822)-GCN5 (KAT2A; MIM 602301)/PCAF (KAT2B; MIM 602303) acetylase (STAGA) complex. Both of these complexes contain either GCN5 or PCAF, which are paralogous acetyltransferases (Wang et al., 2008 [PubMed 18838386]).[supplied by OMIM, Apr 2010]

Uniprot Description

CCDC101: Involved in transcriptional regulation, through association with histone acetyltransferase (HAT) SAGA-type complexes like the TFTC-HAT, ATAC or STAGA complexes. Specifically recognizes and binds methylated 'Lys-4' of histone H3 (H3K4me), with a preference for trimethylated form (H3K4me3). In the SAGA- type complexes, required to recruit complexes to H3K4me. May be involved in MYC-mediated oncogenic transformation. Belongs to the SGF29 family.

Chromosomal Location of Human Ortholog: 16p11.2

Molecular Function: methylated histone residue binding; protein binding

Research Articles on CCDC101

Similar Products

Product Notes

The CCDC101 sgf29 (Catalog #AAA1275957) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccctcg tgtctgccga ttcccgcatt gcagaacttc tcacagagct ccatcagctg atcaaacaaa cccaggaaga gcgttcgcgg agcgaacaca acttagtgaa catccagaag acccatgagc ggatgcagac agagaacaag atttctccct attaccggac aaagctgcgt ggcctctaca caaccgccaa ggccgatgca gaggctgagt gcaacatcct tcggaaagct ctggacaaga tcgcggaaat caagtctctg ttggaagaga ggcggattgc ggccaagatt gccggtctct acaatgactc ggagccaccc cggaagacca tgcgcagagg ggtgctgatg accctgctgc agcagtcggc catgaccctg cccctgtgga tcgggaagcc tggtgacaag cccccacccc tctgtggggc catccctgcc tcaggagact acgtggccag acctggagac aaggtggctg cccgggtgaa ggccgtggat ggggacgagc agtggatcct ggccgaggtg gtcagttaca gccatgccac caacaagtat gaggtagatg acatcgatga agaaggcaaa gagagacaca ccctgagccg gcgccgtgtc atcccgctgc cccagtggaa ggccaacccg gagacggacc ctgaggcctt gttccagaag gagcagctcg tgctggccct gtatccccag actacctgct tctaccgcgc cctgatccat gcgcccccac agcggcccca ggatgactac tcggtcctgt ttgaagacac ctcctatgca gatggctatt cccctcccct caatgtggct cagagatacg tggtggcttg taaggaaccc aagaaaaagt ga. It is sometimes possible for the material contained within the vial of "CCDC101, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.