Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCBE1 cdna clone

CCBE1 cDNA Clone

Gene Names
CCBE1; HKLLS1
Synonyms
CCBE1; CCBE1 cDNA Clone; CCBE1 cdna clone
Ordering
For Research Use Only!
Sequence
atggtgaaagccggaacttgctgtgccacatgcaaggagttctaccagatgaagcagaccgtgctgcagctgaagcaaaagattgctctgctccccaacaatgcagctgacctgggcaagtatatcactggtgacaaggtgctggcctcaaacacctaccttccaggacctcctggcctgcctgggggccagggccctcccggctcaccaggaccaaagggaagcccaggcttccccggtatgccaggccctcctgggcagcccggcccacggggctcaatgggacccatgggaccatctcctgatctgtcccacattaagcaaggccggaggggccctgtgggtccaccaggggcaccaggaagagatggttctaagggggagagaggagcgcctgggcccagagggtctccaggaccccctggttctttcgacttcctgctacttatgctggctgacatccgcaatgacatcactgagctgcaggaaaaggtgttcgggcaccggactcactcttcagcagaggagttccctttacctcaggaatttcccagctacccagaagccatggacctgggctctggagatgaccatccaagaagaactgagacaagagacttgagagcccccagagacttctacccatag
Sequence Length
648
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,600 Da
NCBI Official Full Name
Homo sapiens collagen and calcium binding EGF domains 1, mRNA
NCBI Official Synonym Full Names
collagen and calcium binding EGF domains 1
NCBI Official Symbol
CCBE1
NCBI Official Synonym Symbols
HKLLS1
NCBI Protein Information
collagen and calcium-binding EGF domain-containing protein 1
UniProt Protein Name
Collagen and calcium-binding EGF domain-containing protein 1
UniProt Gene Name
CCBE1
UniProt Synonym Gene Names
KIAA1983
UniProt Entry Name
CCBE1_HUMAN

NCBI Description

This gene is thought to function in extracellular matrix remodeling and migration. It is predominantly expressed in the ovary, but down regulated in ovarian cancer cell lines and primary carcinomas, suggesting its role as a tumour suppressor. Mutations in this gene have been associated with Hennekam lymphangiectasia-lymphedema syndrome, a generalized lymphatic dysplasia in humans. [provided by RefSeq, Mar 2010]

Uniprot Description

CCBE1: Required for lymphangioblast budding and angiogenic sprouting from venous endothelium during embryogenesis. Defects in CCBE1 are the cause of Hennekam lymphangiectasia-lymphedema syndrome (HLLS). HLLS is a generalized lymph-vessels dysplasia characterized by intestinal lymphangiectasia with severe lymphedema of the limbs, genitalia and face. In addition, affected individuals have unusual facies and severe mental retardation. Belongs to the CCBE1 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 18q21.32

Cellular Component: extracellular space; proteinaceous extracellular matrix

Molecular Function: collagen binding; protease binding; protein binding

Biological Process: lymphangiogenesis; sprouting angiogenesis; venous blood vessel morphogenesis

Disease: Hennekam Lymphangiectasia-lymphedema Syndrome 1

Research Articles on CCBE1

Similar Products

Product Notes

The CCBE1 ccbe1 (Catalog #AAA1275500) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgaaag ccggaacttg ctgtgccaca tgcaaggagt tctaccagat gaagcagacc gtgctgcagc tgaagcaaaa gattgctctg ctccccaaca atgcagctga cctgggcaag tatatcactg gtgacaaggt gctggcctca aacacctacc ttccaggacc tcctggcctg cctgggggcc agggccctcc cggctcacca ggaccaaagg gaagcccagg cttccccggt atgccaggcc ctcctgggca gcccggccca cggggctcaa tgggacccat gggaccatct cctgatctgt cccacattaa gcaaggccgg aggggccctg tgggtccacc aggggcacca ggaagagatg gttctaaggg ggagagagga gcgcctgggc ccagagggtc tccaggaccc cctggttctt tcgacttcct gctacttatg ctggctgaca tccgcaatga catcactgag ctgcaggaaa aggtgttcgg gcaccggact cactcttcag cagaggagtt ccctttacct caggaatttc ccagctaccc agaagccatg gacctgggct ctggagatga ccatccaaga agaactgaga caagagactt gagagccccc agagacttct acccatag. It is sometimes possible for the material contained within the vial of "CCBE1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.