Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CBY1 cdna clone

CBY1 cDNA Clone

Gene Names
CBY1; CBY; arb1; PGEA1; C22orf2; PIGEA14; PIGEA-14; HS508I15A
Synonyms
CBY1; CBY1 cDNA Clone; CBY1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcctttctttgggaatacgttcagtccgaagaagacacctcctcggaagtcggcatctctctccaacctgcattctttggatcgatcaacccgggaggtggagctgggcttggaatacggatccccgactatgaacctggcagggcaaagcctgaagtttgaaaatggccagtggatagcagagacaggggttagtggcggtgtggaccggagggaggttcagcgccttcgcaggcggaaccagcagttggaggaagagaacaatctcttgcggctgaaagtggacatcttattagacatgctttcagagtccactgctgaatcccacttaatggagaaggaactggatgaactgaggatcagccggaagagaaaatga
Sequence Length
381
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,470 Da
NCBI Official Full Name
Homo sapiens chibby homolog 1 (Drosophila), mRNA
NCBI Official Synonym Full Names
chibby family member 1, beta catenin antagonist
NCBI Official Symbol
CBY1
NCBI Official Synonym Symbols
CBY; arb1; PGEA1; C22orf2; PIGEA14; PIGEA-14; HS508I15A
NCBI Protein Information
protein chibby homolog 1
UniProt Protein Name
Protein chibby homolog 1
Protein Family
UniProt Gene Name
CBY1
UniProt Synonym Gene Names
ARB1; C22orf2; CBY; PGEA1
UniProt Entry Name
CBY1_HUMAN

NCBI Description

Beta-catenin is a transcriptional activator and oncoprotein involved in the development of several cancers. The protein encoded by this gene interacts directly with the C-terminal region of beta-catenin, inhibiting oncogenic beta-catenin-mediated transcriptional activation by competing with transcription factors for binding to beta-catenin. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

CBY1: Inhibits the Wnt/Wingless pathway by binding to beta- catenin and inhibiting beta-catenin-mediated transcriptional activation through competition with TCF/LEF transcription factors. Has also been shown to play a role in regulating the intracellular trafficking of polycystin-2/PKD2 and possibly of other intracellular proteins. Promotes adipocyte and cardiomyocyte differentiation. Belongs to the chibby family.

Protein type: Transcription regulation

Chromosomal Location of Human Ortholog: 22q12

Cellular Component: cytosol; nucleoplasm; nucleus; trans-Golgi network

Molecular Function: beta-catenin binding; identical protein binding; protein binding

Biological Process: cardiac muscle cell differentiation; fat cell differentiation; negative regulation of transcription, DNA-dependent; negative regulation of Wnt receptor signaling pathway; protein localization

Research Articles on CBY1

Similar Products

Product Notes

The CBY1 cby1 (Catalog #AAA1277727) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctttct ttgggaatac gttcagtccg aagaagacac ctcctcggaa gtcggcatct ctctccaacc tgcattcttt ggatcgatca acccgggagg tggagctggg cttggaatac ggatccccga ctatgaacct ggcagggcaa agcctgaagt ttgaaaatgg ccagtggata gcagagacag gggttagtgg cggtgtggac cggagggagg ttcagcgcct tcgcaggcgg aaccagcagt tggaggaaga gaacaatctc ttgcggctga aagtggacat cttattagac atgctttcag agtccactgc tgaatcccac ttaatggaga aggaactgga tgaactgagg atcagccgga agagaaaatg a. It is sometimes possible for the material contained within the vial of "CBY1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.