Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CBS cdna clone

CBS cDNA Clone

Gene Names
CBS; HIP4
Synonyms
CBS; CBS cDNA Clone; CBS cdna clone
Ordering
For Research Use Only!
Sequence
atgccttctgagaccccccaggcagaagtggggcccacaggctgcccccaccgctcagggccacactcggcgaaggggagcctggagaaggggtccccagaggataaggaagccaaggagcccctgtggatccggcccgatgctccgagcaggtgcacctggcagctgggccggcctgcctccgagtccccacatcaccacactcccccggcaaaatctccaaaaatcttgccagatattctgaagaaaatcggggacacccctatggtcagaatcaacaagattgggaagaagttcggcctgaagtgtgagctcttggccaagtgtgagttcttcaacgcgggcgggagcgtgaaggaccgcatcagcctgcggatgattgaggatgctgagcgcgacgggacgctgaagcccggggacacgattatcgagccgacatccgggaacaccgggatcgggctggccctggctgcggcagtgaggggctatcgctgcatcatcgtgatgccagagaagatgagctccgagaaggtggacgtgctgcgggcactgggggctgagattgtgaggacgcccaccaatgccaggttcgactccccggagtcacacgtgggggtggcctggcggctgaagaacgaaatccccaattctcacatcctagaccagtaccgcaacgccagcaaccccctggctcactacgacaccaccgctgatgagatcctgcagcagtgtgatgggaagctggacatgctggtggcttcagtgggcacgggcggcaccatcacgggcattgccaggaagctgaaggagaagtgtcctggatgcaggatcattggggtggatcccgaagggtccatcctcgcagagccggaggagctgaaccagacggagcagacaacctacgaggtggaagggatcggctacgacttcatccccacggtgctggacaggacggtggtggacaagtggttcaagagcaacgatgaggaggcgttcacctttgcccgcatgctgatcgcgcaagaggggctgctgtgcggtggcagtgctggcagcacggtggcggtggccgtgaaggccgcgcaggagctgcaggagggccagcgctgcgtggtcattctgcccgactcagtgcggaactacatgaccaagttcctgagcgacaggtggatgctgcagaagggctttctgaaggaggaggacctcacggagaagaagccctggtggtggcacctccgtgttcaggagctgggcctgtcagccccgctgaccgtgctcccgaccatcacctgtgggcacaccatcgagatcctccgggagaagggcttcgaccaggcgcccgtggtggatgaggcgggggtaatcctgggaatggtgacgcttgggaacatgctctcgtccctgcttgccgggaaggtgcagccgtcagaccaagttggcaaagtcatctacaagcagttcaaacagatccgcctcacggacacgctgggcaggctctcgcacatcctggagatggaccacttcgccctggtggtgcacgagcagatccagtaccacagcaccgggaagtccagtcagcggcagatggtgttcggggtggtcaccgccattgacttgctgaacttcgtggccgcccaggagcgggaccagaagtga
Sequence Length
1656
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
875
Molecular Weight
61,863 Da
NCBI Official Full Name
Homo sapiens cystathionine-beta-synthase, mRNA
NCBI Official Synonym Full Names
cystathionine-beta-synthase
NCBI Official Symbol
CBS
NCBI Official Synonym Symbols
HIP4
NCBI Protein Information
cystathionine beta-synthase
UniProt Protein Name
Cystathionine beta-synthase
UniProt Gene Name
CBS
UniProt Entry Name
CBS_HUMAN

NCBI Description

The protein encoded by this gene acts as a homotetramer to catalyze the conversion of homocysteine to cystathionine, the first step in the transsulfuration pathway. The encoded protein is allosterically activated by adenosyl-methionine and uses pyridoxal phosphate as a cofactor. Defects in this gene can cause cystathionine beta-synthase deficiency (CBSD), which can lead to homocystinuria. This gene is a major contributor to cellular hydrogen sulfide production. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2016]

Uniprot Description

CBS: Only known pyridoxal phosphate-dependent enzyme that contains heme. Important regulator of hydrogen sulfide, especially in the brain, utilizing cysteine instead of serine to catalyze the formation of hydrogen sulfide. Hydrogen sulfide is a gastratransmitter with signaling and cytoprotective effects such as acting as a neuromodulator in the brain to protect neurons against hypoxic injury. Defects in CBS are the cause of cystathionine beta- synthase deficiency (CBSD). CBSD is an enzymatic deficiency resulting in altered sulfur metabolism and homocystinuria. The clinical features of untreated homocystinuria due to CBS deficiency include myopia, ectopia lentis, mental retardation, skeletal anomalies resembling Marfan syndrome, and thromboembolic events. Light skin and hair can also be present. Biochemical features include increased urinary homocystine and methionine. Belongs to the cysteine synthase/cystathionine beta- synthase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Other Amino Acids Metabolism - selenoamino acid; Lyase; EC 4.2.1.22; Amino Acid Metabolism - glycine, serine and threonine; Amino Acid Metabolism - cysteine and methionine

Chromosomal Location of Human Ortholog: 21q22.3

Cellular Component: cytoplasm; cytosol; nucleus

Molecular Function: cystathionine beta-synthase activity; cysteine synthase activity; enzyme binding; heme binding; identical protein binding; nitrite reductase (NO-forming) activity; oxygen binding; protein binding; protein homodimerization activity; pyridoxal phosphate binding; ubiquitin protein ligase binding

Biological Process: cysteine biosynthetic process; cysteine biosynthetic process from serine; DNA protection; homocysteine catabolic process; homocysteine metabolic process; L-cysteine catabolic process; L-serine catabolic process; L-serine metabolic process; transsulfuration

Disease: Homocystinuria Due To Cystathionine Beta-synthase Deficiency

Research Articles on CBS

Similar Products

Product Notes

The CBS cbs (Catalog #AAA1266204) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccttctg agacccccca ggcagaagtg gggcccacag gctgccccca ccgctcaggg ccacactcgg cgaaggggag cctggagaag gggtccccag aggataagga agccaaggag cccctgtgga tccggcccga tgctccgagc aggtgcacct ggcagctggg ccggcctgcc tccgagtccc cacatcacca cactcccccg gcaaaatctc caaaaatctt gccagatatt ctgaagaaaa tcggggacac ccctatggtc agaatcaaca agattgggaa gaagttcggc ctgaagtgtg agctcttggc caagtgtgag ttcttcaacg cgggcgggag cgtgaaggac cgcatcagcc tgcggatgat tgaggatgct gagcgcgacg ggacgctgaa gcccggggac acgattatcg agccgacatc cgggaacacc gggatcgggc tggccctggc tgcggcagtg aggggctatc gctgcatcat cgtgatgcca gagaagatga gctccgagaa ggtggacgtg ctgcgggcac tgggggctga gattgtgagg acgcccacca atgccaggtt cgactccccg gagtcacacg tgggggtggc ctggcggctg aagaacgaaa tccccaattc tcacatccta gaccagtacc gcaacgccag caaccccctg gctcactacg acaccaccgc tgatgagatc ctgcagcagt gtgatgggaa gctggacatg ctggtggctt cagtgggcac gggcggcacc atcacgggca ttgccaggaa gctgaaggag aagtgtcctg gatgcaggat cattggggtg gatcccgaag ggtccatcct cgcagagccg gaggagctga accagacgga gcagacaacc tacgaggtgg aagggatcgg ctacgacttc atccccacgg tgctggacag gacggtggtg gacaagtggt tcaagagcaa cgatgaggag gcgttcacct ttgcccgcat gctgatcgcg caagaggggc tgctgtgcgg tggcagtgct ggcagcacgg tggcggtggc cgtgaaggcc gcgcaggagc tgcaggaggg ccagcgctgc gtggtcattc tgcccgactc agtgcggaac tacatgacca agttcctgag cgacaggtgg atgctgcaga agggctttct gaaggaggag gacctcacgg agaagaagcc ctggtggtgg cacctccgtg ttcaggagct gggcctgtca gccccgctga ccgtgctccc gaccatcacc tgtgggcaca ccatcgagat cctccgggag aagggcttcg accaggcgcc cgtggtggat gaggcggggg taatcctggg aatggtgacg cttgggaaca tgctctcgtc cctgcttgcc gggaaggtgc agccgtcaga ccaagttggc aaagtcatct acaagcagtt caaacagatc cgcctcacgg acacgctggg caggctctcg cacatcctgg agatggacca cttcgccctg gtggtgcacg agcagatcca gtaccacagc accgggaagt ccagtcagcg gcagatggtg ttcggggtgg tcaccgccat tgacttgctg aacttcgtgg ccgcccagga gcgggaccag aagtga. It is sometimes possible for the material contained within the vial of "CBS, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.