Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CATSPER2 cdna clone

CATSPER2 cDNA Clone

Synonyms
CATSPER2; CATSPER2 cDNA Clone; CATSPER2 cdna clone
Ordering
For Research Use Only!
Sequence
atggccgcttaccaacaagaagagcagatgcagcttccccgagctgatgccattcgttcacgtctcatcgatactttctctctcattgagcatttgcaaggcttgagccaagctgtgccgcggcacactatcaggaagttacttgatccttcccgccagaagaaacttgtattgggagatcaacaccagctagtgcgtttctctataaagcctcagcgtatagaacagatttcacatgcccagaggctgttgagcaggcttcatgtgcgctgcagtcagaggccacctctttctttgtgggccggatgggtccttgagtgtcctctcttcaaaaacttcatcatcttcctggtctttttgaatacgatcatattgatggttgaaatagaattgctggaatccacaaataccaaactatggccattgaagctgaccttggaggtggcagcttggtttatcttgcttattttcatcctggagatccttcttaagtggctatccaacttttctgttttctggaagagtgcctggaatgtctttgactttgttgttaccatgttggtaaggatagagatcctgagggttcgtttagtgggatga
Sequence Length
600
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,437 Da
NCBI Official Full Name
Homo sapiens cation channel, sperm associated 2, mRNA
NCBI Official Synonym Full Names
cation channel sperm associated 2
NCBI Official Symbol
CATSPER2
NCBI Protein Information
cation channel sperm-associated protein 2
UniProt Protein Name
Cation channel sperm-associated protein 2
UniProt Gene Name
CATSPER2
UniProt Synonym Gene Names
CatSper2
UniProt Entry Name
CTSR2_HUMAN

NCBI Description

Calcium ions play a primary role in the regulation of sperm motility. This gene belongs to a family of putative cation channels that are specific to spermatozoa and localize to the flagellum. The protein family features a single repeat with six membrane-spanning segments and a predicted calcium-selective pore region. This gene is part of a tandem repeat on chromosome 15q15; the second copy of this gene is thought to be a pseudogene. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2014]

Uniprot Description

CATSPER2: Voltage-gated calcium channel that plays a central role in calcium-dependent physiological responses essential for successful fertilization, such as sperm hyperactivation, acrosome reaction and chemotaxis towards the oocyte. Activated by extracellular progesterone and prostaglandins following the sequence: progesterone > PGF1-alpha = PGE1 > PGA1 > PGE2 >> PGD2. The primary effect of progesterone activation is to shift voltage dependence towards more physiological, negative membrane potentials; it is not mediated by metabotropic receptors and second messengers. Sperm capacitation enhances the effect of progesterone by providing additional negative shift. Also activated by the elevation of intracellular pH. Defects in CATSPER2 are a cause of deafness-infertility syndrome (DIS). DIS is characterized by deafness and infertility and is caused by large contiguous gene deletions at 15q15.3 that removes both STRC and CATSPER2 genes. Belongs to the cation channel sperm-associated (TC 1.A.1.19) family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 15q15.3

Cellular Component: plasma membrane

Molecular Function: protein binding; voltage-gated calcium channel activity

Biological Process: response to progesterone stimulus; sperm motility; sperm-egg recognition

Disease: Deafness, Sensorineural, And Male Infertility; Spermatogenic Failure 7

Research Articles on CATSPER2

Similar Products

Product Notes

The CATSPER2 catsper2 (Catalog #AAA1270023) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgctt accaacaaga agagcagatg cagcttcccc gagctgatgc cattcgttca cgtctcatcg atactttctc tctcattgag catttgcaag gcttgagcca agctgtgccg cggcacacta tcaggaagtt acttgatcct tcccgccaga agaaacttgt attgggagat caacaccagc tagtgcgttt ctctataaag cctcagcgta tagaacagat ttcacatgcc cagaggctgt tgagcaggct tcatgtgcgc tgcagtcaga ggccacctct ttctttgtgg gccggatggg tccttgagtg tcctctcttc aaaaacttca tcatcttcct ggtctttttg aatacgatca tattgatggt tgaaatagaa ttgctggaat ccacaaatac caaactatgg ccattgaagc tgaccttgga ggtggcagct tggtttatct tgcttatttt catcctggag atccttctta agtggctatc caacttttct gttttctgga agagtgcctg gaatgtcttt gactttgttg ttaccatgtt ggtaaggata gagatcctga gggttcgttt agtgggatga. It is sometimes possible for the material contained within the vial of "CATSPER2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.