Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CAST cdna clone

CAST cDNA Clone

Gene Names
CAST; BS-17; PLACK
Synonyms
CAST; CAST cDNA Clone; CAST cdna clone
Ordering
For Research Use Only!
Sequence
atgaatcccacagaaaccaaggctgtaaaaacagaacctgagaagaagtcacagtcaaccaagccaaaaagcctacccaagcaggcatcagatacaggaagtaacgatgctcacaataaaaaagcagtttccagatcagctgaacagcagccatcagagaaatcaacagaaccaaagactaaaccacaagacatgatttctgctggtggagagagtgttgctggtatcactgcaatatctggcaagccgggtgacaagaaaaaagaaaagaaatcattaaccccagctgtgccagttgaatctaaaccggataaaccatcgggaaagtcaggcatggatgctgctttggatgacttaatagatactttaggaggacctgaagaaactgaagaagaaaatacaacgtatactggaccagaagtttcagatccaatgagttccacctacatagaggaattgggtaaaagagaagtcacaattcctccaaaatatagggaactattggctaaaaaggaagggatcacagggcctcctgcagactcttcgaaacccatagggccagatgatgctatagacgccttgtcatctgacttcacctgtgggtcgcctacagctgctggaaagaaaactgaaaaagaggaatctacagaagttttaaaagctcagtcagcagggacagtcagaagtgctgctccaccccaagagaagaaaagaaaggtggagaaggatacaatgagtgatcaagcactcgaggctctgtcggcttcactgggcacccggcaagcagaacctgagctcgacctccgctcaattaaggaagtcgatgaggcaaaagctaaagaagaaaaactagagaagtgtggtgaggatgatgaaacaatcccatctgagtacagattaaaaccagccacggataaagatggaaaaccactattgccagagcctgaagaaaaacccaagcctcggagtgaatcagaactcattgatgaactttcagaagattttgaccggtctgaatgtaaagagaaaccatctaagccaactgaaaagacagaagaatctaaggccgctgctccagctcctgtgtcggaggctgtgtgtcggacctccatgtgtagtatacagtcagcaccccctgagccggctaccttgaagggcacagtgccagatgatgctgtagaagccttggctgatagcctggggaaaaaggaagcagatccagaagatggaaaacctgtgatggataaagtcaaggagaaggccaaagaagaagaccgtgaaaagcttggtgaaaaagaagaaacaattcctcctgattatagattagaagaggtcaaggataaagatggaaagccactcctgccaaaagagtctaaggaacagcttccacccatgagtgaagacttccttctggatgctttgtctgaggacttctctggtccacaaaatgcttcatctcttaaatttgaagatgctaaacttgctgctgccatctctgaagtggtttcccaaaccccagcttcaacgacccaagctggagccccaccccgtgatacctcgcagagtgacaaagacctcgatgatgccttggataaactctctgacagtctaggacaaaggcagcctgacccagatgagaacaaaccaatggaagataaagtaaaggaaaaagctaaagctgaacatagagacaagcttggagaaagagatgacactatcccacctgaatacagacatctcctggatgataatggacaggacaaaccagtgaagccacctacaaagaaatcagaggattcaaagaaacctgcagatgaccaagaccccattgatgctctctcaggagatctggacagctgtccctccactacagaaacctcacagaacacagcaaaggataagtgcaagaaggctgcttccagctccaaagcacctaagaatggaggtaaagcgaaggattcagcaaagacaacagaggaaacttccaagccaaaagatgactaa
Sequence Length
2004
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
831
Molecular Weight
82,437 Da
NCBI Official Full Name
Homo sapiens calpastatin, mRNA
NCBI Official Synonym Full Names
calpastatin
NCBI Official Symbol
CAST
NCBI Official Synonym Symbols
BS-17; PLACK
NCBI Protein Information
calpastatin
UniProt Protein Name
Calpastatin
Protein Family
UniProt Gene Name
CAST
UniProt Entry Name
ICAL_HUMAN

NCBI Description

The protein encoded by this gene is an endogenous calpain (calcium-dependent cysteine protease) inhibitor. It consists of an N-terminal domain L and four repetitive calpain-inhibition domains (domains 1-4), and it is involved in the proteolysis of amyloid precursor protein. The calpain/calpastatin system is involved in numerous membrane fusion events, such as neural vesicle exocytosis and platelet and red-cell aggregation. The encoded protein is also thought to affect the expression levels of genes encoding structural or regulatory proteins. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jun 2010]

Uniprot Description

calpastatin: Specific inhibition of calpain (calcium-dependent cysteine protease). Plays a key role in postmortem tenderization of meat and have been proposed to be involved in muscle protein degradation in living tissue. Belongs to the protease inhibitor I27 (calpastatin) family. 7 isoforms of the human protein are produced by alternative splicing.

Protein type: Inhibitor

Chromosomal Location of Human Ortholog: 5q15

Cellular Component: cell-cell adherens junction; cytoplasm; cytosol; endoplasmic reticulum; membrane

Molecular Function: endopeptidase inhibitor activity; protein binding

Disease: Peeling Skin With Leukonychia, Acral Punctate Keratoses, Cheilitis, And Knuckle Pads

Research Articles on CAST

Similar Products

Product Notes

The CAST cast (Catalog #AAA1266380) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatccca cagaaaccaa ggctgtaaaa acagaacctg agaagaagtc acagtcaacc aagccaaaaa gcctacccaa gcaggcatca gatacaggaa gtaacgatgc tcacaataaa aaagcagttt ccagatcagc tgaacagcag ccatcagaga aatcaacaga accaaagact aaaccacaag acatgatttc tgctggtgga gagagtgttg ctggtatcac tgcaatatct ggcaagccgg gtgacaagaa aaaagaaaag aaatcattaa ccccagctgt gccagttgaa tctaaaccgg ataaaccatc gggaaagtca ggcatggatg ctgctttgga tgacttaata gatactttag gaggacctga agaaactgaa gaagaaaata caacgtatac tggaccagaa gtttcagatc caatgagttc cacctacata gaggaattgg gtaaaagaga agtcacaatt cctccaaaat atagggaact attggctaaa aaggaaggga tcacagggcc tcctgcagac tcttcgaaac ccatagggcc agatgatgct atagacgcct tgtcatctga cttcacctgt gggtcgccta cagctgctgg aaagaaaact gaaaaagagg aatctacaga agttttaaaa gctcagtcag cagggacagt cagaagtgct gctccacccc aagagaagaa aagaaaggtg gagaaggata caatgagtga tcaagcactc gaggctctgt cggcttcact gggcacccgg caagcagaac ctgagctcga cctccgctca attaaggaag tcgatgaggc aaaagctaaa gaagaaaaac tagagaagtg tggtgaggat gatgaaacaa tcccatctga gtacagatta aaaccagcca cggataaaga tggaaaacca ctattgccag agcctgaaga aaaacccaag cctcggagtg aatcagaact cattgatgaa ctttcagaag attttgaccg gtctgaatgt aaagagaaac catctaagcc aactgaaaag acagaagaat ctaaggccgc tgctccagct cctgtgtcgg aggctgtgtg tcggacctcc atgtgtagta tacagtcagc accccctgag ccggctacct tgaagggcac agtgccagat gatgctgtag aagccttggc tgatagcctg gggaaaaagg aagcagatcc agaagatgga aaacctgtga tggataaagt caaggagaag gccaaagaag aagaccgtga aaagcttggt gaaaaagaag aaacaattcc tcctgattat agattagaag aggtcaagga taaagatgga aagccactcc tgccaaaaga gtctaaggaa cagcttccac ccatgagtga agacttcctt ctggatgctt tgtctgagga cttctctggt ccacaaaatg cttcatctct taaatttgaa gatgctaaac ttgctgctgc catctctgaa gtggtttccc aaaccccagc ttcaacgacc caagctggag ccccaccccg tgatacctcg cagagtgaca aagacctcga tgatgccttg gataaactct ctgacagtct aggacaaagg cagcctgacc cagatgagaa caaaccaatg gaagataaag taaaggaaaa agctaaagct gaacatagag acaagcttgg agaaagagat gacactatcc cacctgaata cagacatctc ctggatgata atggacagga caaaccagtg aagccaccta caaagaaatc agaggattca aagaaacctg cagatgacca agaccccatt gatgctctct caggagatct ggacagctgt ccctccacta cagaaacctc acagaacaca gcaaaggata agtgcaagaa ggctgcttcc agctccaaag cacctaagaa tggaggtaaa gcgaaggatt cagcaaagac aacagaggaa acttccaagc caaaagatga ctaa. It is sometimes possible for the material contained within the vial of "CAST, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.