Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CASK cdna clone

CASK cDNA Clone

Gene Names
CASK; CMG; FGS4; LIN2; TNRC8; CAGH39; CAMGUK; MICPCH; MRXSNA
Synonyms
CASK; CASK cDNA Clone; CASK cdna clone
Ordering
For Research Use Only!
Sequence
atggccgacgacgacgtgctgttcgaggatgtgtacgagctgtgcgaggtgatcggaaagggtcccttcagtgttgtacgacgatgtatcaacagagaaactgggcaacaatttgctgtaaaaattgttgatgtagccaagttcacatcaagtccagggttaagtacagaagatctaaagcgggaagccagtatctgtcatatgctgaaacatccacacattgtagagttattggagacatatagctcagatggaatgctttacatggttttcgaatttatggatggagcagatctgtgttttgaaatcgtaaagcgagctgacgctggttttgtgtacagtgaagctgtagccagccattatatgagacagatactggaagctctacgctactgccatgataataacataattcacagggatgtgaagccccactgtgttctccttgcctcaaaagaaaactcggcacctgttaaacttggaggctttggggtagctattcaattaggggagtctggacttgtagctggaggacgtgttggaacacctcattttatggcaccagaagtggtcaaaagagagccttacggaaagcctgtagacgtctgggggtgcggtgtgatcctttttatcctgctcagtggttgtttgcctttttacggaaccaaggaaagattgtttgaaggcattattaaaggaaaatataagatgaatccaaggcagtggagccatatctctgaaagtgccaaagacctagtacgtcgcatgctgatgctggatccagctgaaaggatcactgtttatgaagcactgaatcacccatggcttaaggagcgggatcgttacgcctacaagattcatcttccagaaacagtagagcagctgaggaaattcaatgcaaggaggaaactaaagggtgcagtactagccgctgtgtcaagtcacaaattcaactcattctatggggatccccctgaagagttaccagatttctccgaagaccctacctcctcaggacttctagcagcagaaagagcagtctcacaggtgctggacagcctggaagagattcatgcgcttacagactgcagtgaaaaggacctagattttctacacagtgttttccaggatcagcatcttcacacactactagatctgtatgacaaaattaacacaaagtcttcaccacaaatcaggaatcctccaagcgatgcagtacagagagccaaagaggtattggaagaaatttcatgttaccctgagaataacgacgcaaaggaactaaagcgtattttaacacaacctcatttcatggccttacttcagactcacgacgtagtggcacatgaagtttacagtgatgaagcattgagggtcacacctcctcccacctctccctatttaaacggcgattctccagaaagtgctaacggagacatggatatggagaatgtgaccagagttcggctggtacagtttcaaaagaacacagatgaaccaatgggaatcactttaaaaatgaatgaactaaatcattgtattgttgcaagaattatgcatgggggcatgattcacaggcaaggtacacttcatgttggtgatgaaattcgagaaatcaatggcatcagtgtggctaaccaaacagtggaacaactgcaaaaaatgcttagggaaatgcgggggagtattaccttcaagattgtgccaagttaccgcactcagtcttcgtcctgtgaggacttgccatcaactacccaaccaaaaggacgacagatctatgtaagagcacaatttgaatatgatccagccaaggatgacctcatcccctgtaaagaagctggcattcgattcagagttggtgacatcatccagattattagtaaggatgatcataattggtggcagggtaaactggaaaactccaaaaatggaactgcaggtctcattccttctcctgaacttcaggaatggcgagtagcttgcattgccatggagaagaccaaacaggagcagcaggccagctgtacttggtttggcaagaaaaagaagcagtacaaagataaatatttggcaaagcacaatgcagatcttgtcacatatgaagaagtagtaaaactgccagcattcaagaggaaaacactagtcttattaggcgcacatggtgttgggagaagacacataaaaaacactctcatcacaaagcacccagaccggtttgcgtaccctattccacatacaaccagacctccaaagaaagacgaagaaaatggaaagaattattactttgtatctcatgaccaaatgatgcaagacatctctaataacgagtacttggagtacggcagccacgaggatgcgatgtatgggacaaaactggagaccatccggaagatccacgagcaggggctgattgcaatactggacgtggagcctcaggcactgaaggtcctgagaactgcagagtttgctccttttgttgttttcattgctgcaccaactattactccaggtttaaatgaggatgaatctcttcagcgtctgcagaaggagtctgacatcttacagagaacatatgcacactacttcgatctcacaattatcaacaatgaaattgatgagacaatcagacatctggaggaagctgttgagctcgtgtgcacagccccacagtgggtccctgtctcctgggtctattag
Sequence Length
2697
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
103,211 Da
NCBI Official Full Name
Homo sapiens calcium/calmodulin-dependent serine protein kinase (MAGUK family), mRNA
NCBI Official Synonym Full Names
calcium/calmodulin dependent serine protein kinase
NCBI Official Symbol
CASK
NCBI Official Synonym Symbols
CMG; FGS4; LIN2; TNRC8; CAGH39; CAMGUK; MICPCH; MRXSNA
NCBI Protein Information
peripheral plasma membrane protein CASK
UniProt Protein Name
Peripheral plasma membrane protein CASK
Protein Family
UniProt Gene Name
CASK
UniProt Synonym Gene Names
LIN2; hCASK
UniProt Entry Name
CSKP_HUMAN

NCBI Description

This gene encodes a calcium/calmodulin-dependent serine protein kinase. The encoded protein is a MAGUK (membrane-associated guanylate kinase) protein family member. These proteins are scaffold proteins and the encoded protein is located at synapses in the brain. Mutations in this gene are associated with FG syndrome 4, mental retardation and microcephaly with pontine and cerebellar hypoplasia, and a form of X-linked mental retardation. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]

Uniprot Description

CASK: a MAGUK family protein and a protein kinase of the CAMK group. Contains one protein kinase domain, one guanylate kinase domain, two L27 domains, one PDZ domain and one SH3 domain. Plays a role in synaptic transmembrane protein anchoring and ion channel trafficking. Contributes to neural development and regulation of gene expression via interaction with the transcription factor TRB1. Binds to cell-surface proteins, including amyloid precursor protein, neurexins and syndecans. May mediate a link between the extracellular matrix and the actin cytoskeleton via its interaction with syndecan and with the actin/spectrin-binding protein 4.1. Lacks the canonical DFG motif required for Mg++ binding, but retains protein kinase activity even without binding Mg++. Six alternatively spliced human isoforms have been described.

Protein type: Adaptor/scaffold; Protein kinase, Ser/Thr (non-receptor); EC 2.7.11.1; Protein kinase, CAMK; Kinase, protein; CAMK group; CASK family

Chromosomal Location of Human Ortholog: Xp11.4

Cellular Component: actin cytoskeleton; basement membrane; cytoplasm; cytosol; focal adhesion; intercellular junction; nuclear lamina; nuclear matrix; nucleolus; plasma membrane; presynaptic membrane

Molecular Function: guanylate kinase activity; protein binding

Biological Process: cell adhesion; negative regulation of cell-matrix adhesion; neurotransmitter secretion

Disease: Fg Syndrome 4; Mental Retardation And Microcephaly With Pontine And Cerebellar Hypoplasia

Research Articles on CASK

Similar Products

Product Notes

The CASK cask (Catalog #AAA1274993) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgacg acgacgtgct gttcgaggat gtgtacgagc tgtgcgaggt gatcggaaag ggtcccttca gtgttgtacg acgatgtatc aacagagaaa ctgggcaaca atttgctgta aaaattgttg atgtagccaa gttcacatca agtccagggt taagtacaga agatctaaag cgggaagcca gtatctgtca tatgctgaaa catccacaca ttgtagagtt attggagaca tatagctcag atggaatgct ttacatggtt ttcgaattta tggatggagc agatctgtgt tttgaaatcg taaagcgagc tgacgctggt tttgtgtaca gtgaagctgt agccagccat tatatgagac agatactgga agctctacgc tactgccatg ataataacat aattcacagg gatgtgaagc cccactgtgt tctccttgcc tcaaaagaaa actcggcacc tgttaaactt ggaggctttg gggtagctat tcaattaggg gagtctggac ttgtagctgg aggacgtgtt ggaacacctc attttatggc accagaagtg gtcaaaagag agccttacgg aaagcctgta gacgtctggg ggtgcggtgt gatccttttt atcctgctca gtggttgttt gcctttttac ggaaccaagg aaagattgtt tgaaggcatt attaaaggaa aatataagat gaatccaagg cagtggagcc atatctctga aagtgccaaa gacctagtac gtcgcatgct gatgctggat ccagctgaaa ggatcactgt ttatgaagca ctgaatcacc catggcttaa ggagcgggat cgttacgcct acaagattca tcttccagaa acagtagagc agctgaggaa attcaatgca aggaggaaac taaagggtgc agtactagcc gctgtgtcaa gtcacaaatt caactcattc tatggggatc cccctgaaga gttaccagat ttctccgaag accctacctc ctcaggactt ctagcagcag aaagagcagt ctcacaggtg ctggacagcc tggaagagat tcatgcgctt acagactgca gtgaaaagga cctagatttt ctacacagtg ttttccagga tcagcatctt cacacactac tagatctgta tgacaaaatt aacacaaagt cttcaccaca aatcaggaat cctccaagcg atgcagtaca gagagccaaa gaggtattgg aagaaatttc atgttaccct gagaataacg acgcaaagga actaaagcgt attttaacac aacctcattt catggcctta cttcagactc acgacgtagt ggcacatgaa gtttacagtg atgaagcatt gagggtcaca cctcctccca cctctcccta tttaaacggc gattctccag aaagtgctaa cggagacatg gatatggaga atgtgaccag agttcggctg gtacagtttc aaaagaacac agatgaacca atgggaatca ctttaaaaat gaatgaacta aatcattgta ttgttgcaag aattatgcat gggggcatga ttcacaggca aggtacactt catgttggtg atgaaattcg agaaatcaat ggcatcagtg tggctaacca aacagtggaa caactgcaaa aaatgcttag ggaaatgcgg gggagtatta ccttcaagat tgtgccaagt taccgcactc agtcttcgtc ctgtgaggac ttgccatcaa ctacccaacc aaaaggacga cagatctatg taagagcaca atttgaatat gatccagcca aggatgacct catcccctgt aaagaagctg gcattcgatt cagagttggt gacatcatcc agattattag taaggatgat cataattggt ggcagggtaa actggaaaac tccaaaaatg gaactgcagg tctcattcct tctcctgaac ttcaggaatg gcgagtagct tgcattgcca tggagaagac caaacaggag cagcaggcca gctgtacttg gtttggcaag aaaaagaagc agtacaaaga taaatatttg gcaaagcaca atgcagatct tgtcacatat gaagaagtag taaaactgcc agcattcaag aggaaaacac tagtcttatt aggcgcacat ggtgttggga gaagacacat aaaaaacact ctcatcacaa agcacccaga ccggtttgcg taccctattc cacatacaac cagacctcca aagaaagacg aagaaaatgg aaagaattat tactttgtat ctcatgacca aatgatgcaa gacatctcta ataacgagta cttggagtac ggcagccacg aggatgcgat gtatgggaca aaactggaga ccatccggaa gatccacgag caggggctga ttgcaatact ggacgtggag cctcaggcac tgaaggtcct gagaactgca gagtttgctc cttttgttgt tttcattgct gcaccaacta ttactccagg tttaaatgag gatgaatctc ttcagcgtct gcagaaggag tctgacatct tacagagaac atatgcacac tacttcgatc tcacaattat caacaatgaa attgatgaga caatcagaca tctggaggaa gctgttgagc tcgtgtgcac agccccacag tgggtccctg tctcctgggt ctattag. It is sometimes possible for the material contained within the vial of "CASK, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.