Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CAPZA2 cdna clone

CAPZA2 cDNA Clone

Gene Names
CAPZA2; CAPZ; CAPPA2
Synonyms
CAPZA2; CAPZA2 cDNA Clone; CAPZA2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggatctggaggagcagttgtctgatgaagagaaggtgcgtatagcagcaaaattcatcattcatgcccctcctggagaatttaatgaggttttcaatgatgttcggttactgcttaataatgacaatcttctcagggaaggagcagcccatgcatttgcacagtataacttggaccagtttactccagtaaaaattgaaggttatgaagatcaggtattgataacagaacatggcgacttgggaaatggaaagtttttggatccaaagaacagaatctgttttaaatttgatcacttaaggaaggaggcaactgatccaagaccatgtgaagtagaaaatgcagttgaatcatggagaacttcagtagaaactgctctgagagcttacgtaaaagaacattacccgaatggagtctgcactgtgtatggcaaaaaaatagatggacagcaaaccattattgcatgcatagaaagccatcagttccaagcaaaaaatttttggaatggtcgttggaggtcagaatggaagtttacaatcactccttcaaccactcaagtggttggcatcttgaaaattcaggttcattattatgaagatggtaatgttcagctagtgagtcataaagatatacaagattccctaacagtgtctaatgaagtgcaaacagcaaaagaatttataaagattgtagaagctgcagaaaatgaataccagactgccatcagtgagaattatcagacaatgtcggacactactttcaaagccttacgtcgacagttgccagttacacgcactaagattgattggaacaagatccttagctacaagattggcaaagagatgcagaatgcataa
Sequence Length
861
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
830
Molecular Weight
19,775 Da
NCBI Official Full Name
Homo sapiens capping protein (actin filament) muscle Z-line, alpha 2, mRNA
NCBI Official Synonym Full Names
capping actin protein of muscle Z-line alpha subunit 2
NCBI Official Symbol
CAPZA2
NCBI Official Synonym Symbols
CAPZ; CAPPA2
NCBI Protein Information
F-actin-capping protein subunit alpha-2
UniProt Protein Name
F-actin-capping protein subunit alpha-2
Protein Family
UniProt Gene Name
CAPZA2
UniProt Entry Name
CAZA2_HUMAN

NCBI Description

The protein encoded by this gene is a member of the F-actin capping protein alpha subunit family. It is the alpha subunit of the barbed-end actin binding protein Cap Z. By capping the barbed end of actin filaments, Cap Z regulates the growth of the actin filaments at the barbed end. [provided by RefSeq, Jul 2008]

Uniprot Description

CAPZA2: F-actin-capping proteins bind in a Ca(2+)-independent manner to the fast growing ends of actin filaments (barbed end) thereby blocking the exchange of subunits at these ends. Unlike other capping proteins (such as gelsolin and severin), these proteins do not sever actin filaments. Belongs to the F-actin-capping protein alpha subunit family.

Protein type: Motility/polarity/chemotaxis; Cytoskeletal

Chromosomal Location of Human Ortholog: 7q31.2-q31.3

Cellular Component: actin cytoskeleton; cytosol; extracellular region

Biological Process: blood coagulation; cell motility; innate immune response; protein complex assembly

Similar Products

Product Notes

The CAPZA2 capza2 (Catalog #AAA1269163) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggatc tggaggagca gttgtctgat gaagagaagg tgcgtatagc agcaaaattc atcattcatg cccctcctgg agaatttaat gaggttttca atgatgttcg gttactgctt aataatgaca atcttctcag ggaaggagca gcccatgcat ttgcacagta taacttggac cagtttactc cagtaaaaat tgaaggttat gaagatcagg tattgataac agaacatggc gacttgggaa atggaaagtt tttggatcca aagaacagaa tctgttttaa atttgatcac ttaaggaagg aggcaactga tccaagacca tgtgaagtag aaaatgcagt tgaatcatgg agaacttcag tagaaactgc tctgagagct tacgtaaaag aacattaccc gaatggagtc tgcactgtgt atggcaaaaa aatagatgga cagcaaacca ttattgcatg catagaaagc catcagttcc aagcaaaaaa tttttggaat ggtcgttgga ggtcagaatg gaagtttaca atcactcctt caaccactca agtggttggc atcttgaaaa ttcaggttca ttattatgaa gatggtaatg ttcagctagt gagtcataaa gatatacaag attccctaac agtgtctaat gaagtgcaaa cagcaaaaga atttataaag attgtagaag ctgcagaaaa tgaataccag actgccatca gtgagaatta tcagacaatg tcggacacta ctttcaaagc cttacgtcga cagttgccag ttacacgcac taagattgat tggaacaaga tccttagcta caagattggc aaagagatgc agaatgcata a. It is sometimes possible for the material contained within the vial of "CAPZA2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.