CAPN5 cdna clone
CAPN5 cDNA Clone
Gene Names
CAPN5; VRNI; ADNIV; HTRA3; nCL-3
Synonyms
CAPN5; CAPN5 cDNA Clone; CAPN5 cdna clone
Sequence
atgttctcgtgtgtgaagccctatgaggaccagaactactcagccctgaggcgggactgccggcgcaggaaggtgctcttcgaggaccccctcttccccgccactgacgactcactctactataagggcacgccggggcccgccgtcaggtggaagcgacccaagggcatctgcgaggacccccgcctctttgtggatggcatcagctcccacgacctgcaccagggccaggtgggcaactgctggtttgtggcagcctgctcgtcacttgcctcccgggagtcgctgtggcaaaaggtcatcccagactggaaggagcaggaatgggaccccgaaaagcccaacgcctacgcgggcatcttccacttccacttctggcgcttcggggaatgggtggacgtggtcatcgatgaccggctgcccacagtcaacaaccagctcatctactgccactccaactcccgcaatgagttttggtgcgccctagtggagaaggcctatgccaaactggcaggctgttaccaggccctggatggaggcaacacagcagacgcactggtggacttcacgggtggtgtttctgagcccatcgacctgaccgagggtgactttgccaacgatgagactaagaggaaccagctctttgagcgcatgttaaaggtgcacagccggggcggcctcatcagtgcctccatcaaggcagtgacagcagctgacatggaggcccgcctggcgtgcggcctggtaaagggccacgcatacgccgtcactgatgtgcgcaaggtgcgcctgggccacggcctactggccttcttcaagtcagagaagttggacatgatccgcctgcgcaacccctggggcgagcgggagtggaacgggccctggagtgacacctcggaggagtggcagaaagtgagcaagagtgagcgggagaagatgggtgtgaccgtgcaggacgacggtgagttctggatgaccttcgaggacgtgtgccggtacttcacggacatcatcaagtgccgcgtgatcaacacatcccacctgagcatccacaagacgtgggaggaggcccggctgcatggcgcctggacgctgcatgaggacccgcgacagaaccgcggtggcggctgcatcaaccacaaggacaccttcttccagaacccacagtacatcttcgaagtcaagaagccagaagatgaagtcctgatctgcatccagcagcggccaaagcggtctacgcgccgggagggcaagggtgagaacctggccattggctttgacatctacaaggtggaggagaaccgccagtaccgcatgcacagcctgcagcacaaggccgccagctccatctacatcaactcacgcagcgtcttcctgcgcaccgaccagcccgagggccgctatgtcatcatccccacaaccttcgagccaggccacactggcgagttcctgctccgagtcttcactgatgtgccctccaactgccgggagctgcgcctggatgagcccccacacacctgctggagctccctctgtggctacccccagctggtgacccaggtacatgtcctgggagctgctggcctcaaggactccccaacaggggctaactcttatgtgatcatcaagtgtgagggagacaaagtccgctcggctgtgcagaagggcacctccacaccagagtacaatgtgaaaggcatcttctaccgcaagaagctgagccagcccatcactgtacaggtctggaaccaccgagtgctgaaggatgaatttctgggccaggtgcacctaaaggctgacccggacaacctccaggccctgcataccctccacctccgggaccgaaatagccggcagcccagcaacctgccaggcactgtggccgtgcacattctcagcagcacctccctcatggctgtctga
Sequence Length
1923
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
73,169 Da
NCBI Official Full Name
Homo sapiens calpain 5, mRNA
NCBI Official Synonym Full Names
calpain 5
NCBI Official Symbol
CAPN5
NCBI Official Synonym Symbols
VRNI; ADNIV; HTRA3; nCL-3
NCBI Protein Information
calpain-5
UniProt Protein Name
Calpain-5
Protein Family
UniProt Gene Name
CAPN5
UniProt Synonym Gene Names
NCL3; nCL-3
UniProt Entry Name
CAN5_HUMAN
NCBI Description
Calpains are calcium-dependent cysteine proteases involved in signal transduction in a variety of cellular processes. A functional calpain protein consists of an invariant small subunit and 1 of a family of large subunits. CAPN5 is one of the large subunits. Unlike some of the calpains, CAPN5 and CAPN6 lack a calmodulin-like domain IV. Because of the significant similarity to Caenorhabditis elegans sex determination gene tra-3, CAPN5 is also called as HTRA3. [provided by RefSeq, Jul 2008]
Uniprot Description
CAPN5: Calpains are calcium-dependent cysteine proteases involved in signal transduction in a variety of cellular processes. A functional calpain protein consists of an invariant small subunit and 1 of a family of large subunits. CAPN5 is one of the large subunits. Unlike some of the calpains, CAPN5 and CAPN6 lack a calmodulin-like domain IV. Because of the significant similarity to Caenorhabditis elegans sex determination gene tra-3, CAPN5 is also called as HTRA3. [provided by RefSeq, Jul 2008]
Protein type: Protease; EC 3.4.22.-
Chromosomal Location of Human Ortholog: 11q14
Cellular Component: cell surface; cytoplasm; focal adhesion
Biological Process: signal transduction
Disease: Vitreoretinopathy, Neovascular Inflammatory
Research Articles on CAPN5
Similar Products
Product Notes
The CAPN5 capn5 (Catalog #AAA1272514) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttctcgt gtgtgaagcc ctatgaggac cagaactact cagccctgag gcgggactgc cggcgcagga aggtgctctt cgaggacccc ctcttccccg ccactgacga ctcactctac tataagggca cgccggggcc cgccgtcagg tggaagcgac ccaagggcat ctgcgaggac ccccgcctct ttgtggatgg catcagctcc cacgacctgc accagggcca ggtgggcaac tgctggtttg tggcagcctg ctcgtcactt gcctcccggg agtcgctgtg gcaaaaggtc atcccagact ggaaggagca ggaatgggac cccgaaaagc ccaacgccta cgcgggcatc ttccacttcc acttctggcg cttcggggaa tgggtggacg tggtcatcga tgaccggctg cccacagtca acaaccagct catctactgc cactccaact cccgcaatga gttttggtgc gccctagtgg agaaggccta tgccaaactg gcaggctgtt accaggccct ggatggaggc aacacagcag acgcactggt ggacttcacg ggtggtgttt ctgagcccat cgacctgacc gagggtgact ttgccaacga tgagactaag aggaaccagc tctttgagcg catgttaaag gtgcacagcc ggggcggcct catcagtgcc tccatcaagg cagtgacagc agctgacatg gaggcccgcc tggcgtgcgg cctggtaaag ggccacgcat acgccgtcac tgatgtgcgc aaggtgcgcc tgggccacgg cctactggcc ttcttcaagt cagagaagtt ggacatgatc cgcctgcgca acccctgggg cgagcgggag tggaacgggc cctggagtga cacctcggag gagtggcaga aagtgagcaa gagtgagcgg gagaagatgg gtgtgaccgt gcaggacgac ggtgagttct ggatgacctt cgaggacgtg tgccggtact tcacggacat catcaagtgc cgcgtgatca acacatccca cctgagcatc cacaagacgt gggaggaggc ccggctgcat ggcgcctgga cgctgcatga ggacccgcga cagaaccgcg gtggcggctg catcaaccac aaggacacct tcttccagaa cccacagtac atcttcgaag tcaagaagcc agaagatgaa gtcctgatct gcatccagca gcggccaaag cggtctacgc gccgggaggg caagggtgag aacctggcca ttggctttga catctacaag gtggaggaga accgccagta ccgcatgcac agcctgcagc acaaggccgc cagctccatc tacatcaact cacgcagcgt cttcctgcgc accgaccagc ccgagggccg ctatgtcatc atccccacaa ccttcgagcc aggccacact ggcgagttcc tgctccgagt cttcactgat gtgccctcca actgccggga gctgcgcctg gatgagcccc cacacacctg ctggagctcc ctctgtggct acccccagct ggtgacccag gtacatgtcc tgggagctgc tggcctcaag gactccccaa caggggctaa ctcttatgtg atcatcaagt gtgagggaga caaagtccgc tcggctgtgc agaagggcac ctccacacca gagtacaatg tgaaaggcat cttctaccgc aagaagctga gccagcccat cactgtacag gtctggaacc accgagtgct gaaggatgaa tttctgggcc aggtgcacct aaaggctgac ccggacaacc tccaggccct gcataccctc cacctccggg accgaaatag ccggcagccc agcaacctgc caggcactgt ggccgtgcac attctcagca gcacctccct catggctgtc tga. It is sometimes possible for the material contained within the vial of "CAPN5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
