Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

CAPN3 cdna clone

CAPN3 cDNA Clone

Gene Names
CAPN3; p94; CANP3; LGMD2; nCL-1; CANPL3; LGMD2A
Synonyms
CAPN3; CAPN3 cDNA Clone; CAPN3 cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
atggagatctgtgcagatgagctcaagaaggtccttaacacagtcgtgaacaaacacaaggacctgaagacacacgggttcacactggagtcctgccgtagcatgattgcgctcatggatacagatggctctggaaagctcaacctgcaggagttccaccacctctggaacaagattaaggcctggcagaaaattttcaaacactatgacacagaccagtccggcaccatcaacagctacgagatgcgaaatgcagtcaacgacgcaggattccacctcaacaaccagctctatgacatcattaccatgcggtacgcagacaaacacatgaacatcgactttgacagtttcatctgctgcttcgttaggctggagggcatgttcagagcttttcatgcatttgacaaggatggagatggtatcatcaagctcaacgttctggagtggctgcagctcaccatgtatgcctga
Sequence Length
471
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
825
Molecular Weight
18,246 Da
NCBI Official Full Name
Homo sapiens calpain 3, (p94), mRNA
NCBI Official Synonym Full Names
calpain 3
NCBI Official Symbol
CAPN3
NCBI Official Synonym Symbols
p94; CANP3; LGMD2; nCL-1; CANPL3; LGMD2A
NCBI Protein Information
calpain-3
UniProt Protein Name
Calpain-3
Protein Family
UniProt Gene Name
CAPN3
UniProt Synonym Gene Names
CANP3; CANPL3; NCL1; CANP 3; nCL-1
UniProt Entry Name
CAN3_HUMAN

NCBI Description

Calpain, a heterodimer consisting of a large and a small subunit, is a major intracellular protease, although its function has not been well established. This gene encodes a muscle-specific member of the calpain large subunit family that specifically binds to titin. Mutations in this gene are associated with limb-girdle muscular dystrophies type 2A. Alternate promoters and alternative splicing result in multiple transcript variants encoding different isoforms and some variants are ubiquitously expressed. [provided by RefSeq, Jul 2008]

Uniprot Description

CAPN3: Calcium-regulated non-lysosomal thiol-protease. Defects in CAPN3 are the cause of limb-girdle muscular dystrophy type 2A (LGMD2A). LGMD2A is an autosomal recessive degenerative myopathy characterized by progressive symmetrical atrophy and weakness of the proximal limb muscles and elevated serum creatine kinase. The symptoms usually begin during the first two decades of life, and the disease gradually worsens, often resulting in loss of walking ability 10 or 20 years after onset. Belongs to the peptidase C2 family. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Calcium-binding; EC 3.4.22.54; Cell development/differentiation; Protease; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 15q15.1

Cellular Component: cytoplasm; cytosol; intracellular; myofibril; nucleus; plasma membrane; protein complex; T-tubule; Z disc

Molecular Function: calcium ion binding; calcium-dependent cysteine-type endopeptidase activity; catalytic activity; cysteine-type peptidase activity; ligase regulator activity; peptidase activity; protein binding; protein complex scaffold; signal transducer activity; sodium ion binding; structural constituent of muscle; titin binding

Biological Process: activation of NF-kappaB transcription factor; apoptosis; muscle development; muscle maintenance; myofibril assembly; negative regulation of apoptosis; negative regulation of protein sumoylation; negative regulation of transcription, DNA-dependent; positive regulation of proteolysis; positive regulation of release of sequestered calcium ion into cytosol; positive regulation of satellite cell activation involved in skeletal muscle regeneration; positive regulation of transcription, DNA-dependent; protein complex assembly; proteolysis; regulation of catalytic activity; regulation of I-kappaB kinase/NF-kappaB cascade; response to calcium ion; response to muscle activity; sarcomere organization

Disease: Muscular Dystrophy, Limb-girdle, Type 2a

Research Articles on CAPN3

Similar Products

Product Notes

The CAPN3 capn3 (Catalog #AAA1269767) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagatct gtgcagatga gctcaagaag gtccttaaca cagtcgtgaa caaacacaag gacctgaaga cacacgggtt cacactggag tcctgccgta gcatgattgc gctcatggat acagatggct ctggaaagct caacctgcag gagttccacc acctctggaa caagattaag gcctggcaga aaattttcaa acactatgac acagaccagt ccggcaccat caacagctac gagatgcgaa atgcagtcaa cgacgcagga ttccacctca acaaccagct ctatgacatc attaccatgc ggtacgcaga caaacacatg aacatcgact ttgacagttt catctgctgc ttcgttaggc tggagggcat gttcagagct tttcatgcat ttgacaagga tggagatggt atcatcaagc tcaacgttct ggagtggctg cagctcacca tgtatgcctg a. It is sometimes possible for the material contained within the vial of "CAPN3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.
Looking for a specific manual?
Request a Manual