Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CAPN2 cdna clone

CAPN2 cDNA Clone

Gene Names
CAPN2; CANP2; mCANP; CANPL2; CANPml
Synonyms
CAPN2; CAPN2 cDNA Clone; CAPN2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgggcatcgcggccaagctggcgaaggaccgggaggcggccgaggggctgggctcccacgagagggccatcaagtacctcaaccaggactacgaggcgctgcggaacgagtgcctggaggccgggacgctcttccaggacccgtccttcccggccatcccctcggccctgggcttcaaggagttggggccctactccagcaaaacccggggcatcgagtggaagcgccccacggagatctgcgctgacccccagtttatcattggaggagccacccgcacagacatctgccaaggagccctaggtgactgctggctgctggcagccattgcctccctcaccttgaatgaagaaatcctggctcgagtcgtccccctaaaccagagcttccaggaaaactatgcagggatctttcacttccagttctggcaatacggcgagtgggtggaggtggtggtggatgacaggctgcccaccaaggacggggagctgctctttgtgcattcagccgaagggagcgagttctggagcgccctgctggagaaggcatacgccaagatcaacggatgctatgaagcactatcagggggtgccaccactgagggcttcgaagacttcaccggaggcattgctgagtggtatgagttgaagaagccccctcccaacctgttcaagatcatccagaaagctctgcaaaaaggctctctccttggctgctccatcgacatcaccagcgccgcggactcggaggccatcacgtttcagaagctggtgaaggggcacgcgtactcggtcaccggagccgaggaggttgaaagtaacggaagcctacagaaactgatccgcatccgaaatccctggggagaagtggagtggacagggcggtggaatgacaactgcccaagctggaacactatagacccagaggagagggaaaggctgaccagacggcatgaagatggagaattctggatgtctttcagtgacttcctgaggcactattcccgcctggagatctgtaacctgaccccagacactctcaccagcgatacctacaagaagtggaaactcaccaaaatggatgggaactggaggcggggctccaccgcgggaggttgcaggaactacccgaacacattctggatgaaccctcagtacctgatcaagctggaggaggaggatgaggacgaggaggatggggagagcggctgcaccttcctggtggggctcattcagaagcaccgacggcggcagaggaagatgggcgaggacatgcacaccatcggctttggcatctatgaggttccagaggagttaagtgggcagaccaacatccacctcagcaaaaacttcttcctgacgaatcgcgccagggagcgctcagacaccttcatcaacctccgggaggtgctcaaccgcttcaagctgccgccaggagagtacattctcgtgccttccaccttcgaacccaacaaggatggggatttctgcatccgggtcttttctgaaaagaaagctgactaccaagctgtcgatgatgaaatcgaggccaatcttgaagagttcgacatcagcgaggatgacattgatgatggattcaggagactgtttgcccagttggcaggagaggatgcggagatctctgcctttgagctgcagaccatcctgagaagggttctagcaaagcgccaagatatcaagtcagatggcttcagcatcgagacatgcaaaattatggttgacatgctagattcggacgggagtggcaagctggggctgaaggagttctacattctctggacgaagattcaaaaataccaaaaaatttaccgagaaatcgacgttgacaggtctggtaccatgaattcctatgaaatgcggaaggcattagaagaagcaggtttcaagatgccctgtcaactccaccaagtcatcgttgctcggtttgcagatgaccagctcatcatcgattttgataattttgttcggtgtttggttcggctggaaacgctattcaagatatttaagcagctggatcccgagaatactggaacaatagagctcgaccttatctcttggctctgtttctcagtactttga
Sequence Length
2103
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
824
Molecular Weight
71,476 Da
NCBI Official Full Name
Homo sapiens calpain 2, (m/II) large subunit, mRNA
NCBI Official Synonym Full Names
calpain 2
NCBI Official Symbol
CAPN2
NCBI Official Synonym Symbols
CANP2; mCANP; CANPL2; CANPml
NCBI Protein Information
calpain-2 catalytic subunit
UniProt Protein Name
Calpain-2 catalytic subunit
Protein Family
UniProt Gene Name
CAPN2
UniProt Synonym Gene Names
CANPL2; CANP 2; M-calpain
UniProt Entry Name
CAN2_HUMAN

NCBI Description

The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes the large subunit of the ubiquitous enzyme, calpain 2. Multiple heterogeneous transcriptional start sites in the 5' UTR have been reported. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]

Uniprot Description

CAPN2: Calcium-regulated non-lysosomal thiol-protease which catalyze limited proteolysis of substrates involved in cytoskeletal remodeling and signal transduction. Forms a heterodimer with a small (regulatory) subunit (CAPNS1). Ubiquitous. Activated by 200-1000 micromolar concentrations of calcium and inhibited by calpastatin. Belongs to the peptidase C2 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.4.22.53; Motility/polarity/chemotaxis; Protease

Chromosomal Location of Human Ortholog: 1q41-q42

Cellular Component: cortical actin cytoskeleton; cytoplasm; cytosol; dendrite; endoplasmic reticulum; focal adhesion; Golgi apparatus; lipid raft; plasma membrane; pseudopodium

Molecular Function: calcium-dependent cysteine-type endopeptidase activity; cysteine-type peptidase activity; protein binding

Biological Process: extracellular matrix disassembly; proteolysis; proteolysis involved in cellular protein catabolic process; regulation of cytoskeleton organization and biogenesis

Research Articles on CAPN2

Similar Products

Product Notes

The CAPN2 capn2 (Catalog #AAA1274805) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgggca tcgcggccaa gctggcgaag gaccgggagg cggccgaggg gctgggctcc cacgagaggg ccatcaagta cctcaaccag gactacgagg cgctgcggaa cgagtgcctg gaggccggga cgctcttcca ggacccgtcc ttcccggcca tcccctcggc cctgggcttc aaggagttgg ggccctactc cagcaaaacc cggggcatcg agtggaagcg ccccacggag atctgcgctg acccccagtt tatcattgga ggagccaccc gcacagacat ctgccaagga gccctaggtg actgctggct gctggcagcc attgcctccc tcaccttgaa tgaagaaatc ctggctcgag tcgtccccct aaaccagagc ttccaggaaa actatgcagg gatctttcac ttccagttct ggcaatacgg cgagtgggtg gaggtggtgg tggatgacag gctgcccacc aaggacgggg agctgctctt tgtgcattca gccgaaggga gcgagttctg gagcgccctg ctggagaagg catacgccaa gatcaacgga tgctatgaag cactatcagg gggtgccacc actgagggct tcgaagactt caccggaggc attgctgagt ggtatgagtt gaagaagccc cctcccaacc tgttcaagat catccagaaa gctctgcaaa aaggctctct ccttggctgc tccatcgaca tcaccagcgc cgcggactcg gaggccatca cgtttcagaa gctggtgaag gggcacgcgt actcggtcac cggagccgag gaggttgaaa gtaacggaag cctacagaaa ctgatccgca tccgaaatcc ctggggagaa gtggagtgga cagggcggtg gaatgacaac tgcccaagct ggaacactat agacccagag gagagggaaa ggctgaccag acggcatgaa gatggagaat tctggatgtc tttcagtgac ttcctgaggc actattcccg cctggagatc tgtaacctga ccccagacac tctcaccagc gatacctaca agaagtggaa actcaccaaa atggatggga actggaggcg gggctccacc gcgggaggtt gcaggaacta cccgaacaca ttctggatga accctcagta cctgatcaag ctggaggagg aggatgagga cgaggaggat ggggagagcg gctgcacctt cctggtgggg ctcattcaga agcaccgacg gcggcagagg aagatgggcg aggacatgca caccatcggc tttggcatct atgaggttcc agaggagtta agtgggcaga ccaacatcca cctcagcaaa aacttcttcc tgacgaatcg cgccagggag cgctcagaca ccttcatcaa cctccgggag gtgctcaacc gcttcaagct gccgccagga gagtacattc tcgtgccttc caccttcgaa cccaacaagg atggggattt ctgcatccgg gtcttttctg aaaagaaagc tgactaccaa gctgtcgatg atgaaatcga ggccaatctt gaagagttcg acatcagcga ggatgacatt gatgatggat tcaggagact gtttgcccag ttggcaggag aggatgcgga gatctctgcc tttgagctgc agaccatcct gagaagggtt ctagcaaagc gccaagatat caagtcagat ggcttcagca tcgagacatg caaaattatg gttgacatgc tagattcgga cgggagtggc aagctggggc tgaaggagtt ctacattctc tggacgaaga ttcaaaaata ccaaaaaatt taccgagaaa tcgacgttga caggtctggt accatgaatt cctatgaaat gcggaaggca ttagaagaag caggtttcaa gatgccctgt caactccacc aagtcatcgt tgctcggttt gcagatgacc agctcatcat cgattttgat aattttgttc ggtgtttggt tcggctggaa acgctattca agatatttaa gcagctggat cccgagaata ctggaacaat agagctcgac cttatctctt ggctctgttt ctcagtactt tga. It is sometimes possible for the material contained within the vial of "CAPN2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.