Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CAPN13 cdna clone

CAPN13 cDNA Clone

Synonyms
CAPN13; CAPN13 cDNA Clone; CAPN13 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgtattaccaggagccttcagtggagacctccatcatcaagttcaaagaccaggactttaccaccttgcgggatcactgcctgagcatgggccggacgtttaaggatgagacattccctgcagcagattcttccataggccagaagctgctccaggaaaaacgcctctccaatgtgatatggaagcggccacaggatctaccagggggtcctcctcacttcatcctggatgatataagcagatttgacatccaacaaggaggcgcagctgactgctggttcctggcagcactgggatccttgactcagaacccacagtacaggcagaagatcctgatggtccaaagcttttcacaccagtatgctggcattttccgtttccggttctggcaatgtggccagtgggtggaagtggtgattgatgaccgcctacctgtccagggagataaatgcctctttgtgcgtcctcgccaccaaaaccaagagttctggccctgcctgctggagaaggcctatgccaagctgctcggatcctattccgatctgcactatggcttcctcgaggatgccctggtggacctcacaggaggcgtgatcaccaacatccatctgcactcttcccctgtggacctggtgaaggcagtgaagacagcgaccaaggcaggctccctgataacctgtgccactccaagtgggccaacagatacagcacaggcgatggagaatgggctggtgagtctccatgcctacactgtgactggggctgagcagattcaataccgaaggggctgggaagaaattatctccctgtggaacccctggggctggggcgagaccgaatggagagggcgctggagtgatgggtctcaggagtgggaggaaacctgtgatccgcggaaaagccagctacataagaaacgggaagatggcgagttttggatgtcgtgtcaagatttccaacagaaattcatcgccatgtttatatgtagcgaaattccaattaccctggaccatggaaacacactccacgaaggatggtcccaaataatgtttaggaagcaagtgattctaggaaacactgcaggaggacctcggaatgatgctcaattcaacttctctgtgcaagagccaatggaaggcaccaatgttgtcgtgtgcgtcacagttgctgtcacaccatcaaatttgaaagcagaagatgcaaaatttccactcgatttccaagtgattctggctggctcacagcggttccgggagaaatttccacccgtgtttttttcctcgttcagaaacactgtccaaagctcaaataataaattccgccgcaacttcaccatgacttaccatctgagccctgggaactatgttgtggttgcacagacacggagaaaatcagcggagttcttgctccgaatcttcctgaaaatgccagacagtgacaggcacctgagcagccatttcaacctcagaatgaagggaagcccttcagaacatggctcccaacaaagcattttcaacagatatgctcagcagaggctggacattgatgccacccagcttcagggccttctcaaccaggagcttctaacaggacctccaggggacatgttctccttagatgagtgccgcagcttggtggctctgatggaactgaaagtgaatgggcggctagaccaagaggagtttgcgcgactgtggaagcgccttgttcactaccagcatgttttccagaaggttcagacaagccctggagtcctcctgagctcggacttgtggaaggccatagagaatacagacttcctcagagggatcttcatcagccgtgagctgctgcatctggtgaccctcaggtacagcgacagcgtcggcagggtcagcttccccagcctggtctgcttcctgatgcggcttgaagccatggcaaagaccttccgcaacctctctaaggatggaaaaggactctacctgacagaaatggagtggatgagcctggtcatgtacaactga
Sequence Length
2010
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,002 Da
NCBI Official Full Name
Homo sapiens calpain 13, mRNA
NCBI Official Synonym Full Names
calpain 13
NCBI Official Symbol
CAPN13
NCBI Protein Information
calpain-13
UniProt Protein Name
Calpain-13
Protein Family
UniProt Gene Name
CAPN13
UniProt Synonym Gene Names
CANP 13
UniProt Entry Name
CAN13_HUMAN

NCBI Description

The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes a member of the calpain large subunit family. [provided by RefSeq, Jun 2012]

Uniprot Description

CAPN13: Probable non-lysosomal thiol-protease. Belongs to the peptidase C2 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.4.22.-; Protease

Chromosomal Location of Human Ortholog: 2p22-p21

Cellular Component: cytoplasm

Molecular Function: calcium-dependent cysteine-type endopeptidase activity

Biological Process: proteolysis

Research Articles on CAPN13

Similar Products

Product Notes

The CAPN13 capn13 (Catalog #AAA1270520) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgtatt accaggagcc ttcagtggag acctccatca tcaagttcaa agaccaggac tttaccacct tgcgggatca ctgcctgagc atgggccgga cgtttaagga tgagacattc cctgcagcag attcttccat aggccagaag ctgctccagg aaaaacgcct ctccaatgtg atatggaagc ggccacagga tctaccaggg ggtcctcctc acttcatcct ggatgatata agcagatttg acatccaaca aggaggcgca gctgactgct ggttcctggc agcactggga tccttgactc agaacccaca gtacaggcag aagatcctga tggtccaaag cttttcacac cagtatgctg gcattttccg tttccggttc tggcaatgtg gccagtgggt ggaagtggtg attgatgacc gcctacctgt ccagggagat aaatgcctct ttgtgcgtcc tcgccaccaa aaccaagagt tctggccctg cctgctggag aaggcctatg ccaagctgct cggatcctat tccgatctgc actatggctt cctcgaggat gccctggtgg acctcacagg aggcgtgatc accaacatcc atctgcactc ttcccctgtg gacctggtga aggcagtgaa gacagcgacc aaggcaggct ccctgataac ctgtgccact ccaagtgggc caacagatac agcacaggcg atggagaatg ggctggtgag tctccatgcc tacactgtga ctggggctga gcagattcaa taccgaaggg gctgggaaga aattatctcc ctgtggaacc cctggggctg gggcgagacc gaatggagag ggcgctggag tgatgggtct caggagtggg aggaaacctg tgatccgcgg aaaagccagc tacataagaa acgggaagat ggcgagtttt ggatgtcgtg tcaagatttc caacagaaat tcatcgccat gtttatatgt agcgaaattc caattaccct ggaccatgga aacacactcc acgaaggatg gtcccaaata atgtttagga agcaagtgat tctaggaaac actgcaggag gacctcggaa tgatgctcaa ttcaacttct ctgtgcaaga gccaatggaa ggcaccaatg ttgtcgtgtg cgtcacagtt gctgtcacac catcaaattt gaaagcagaa gatgcaaaat ttccactcga tttccaagtg attctggctg gctcacagcg gttccgggag aaatttccac ccgtgttttt ttcctcgttc agaaacactg tccaaagctc aaataataaa ttccgccgca acttcaccat gacttaccat ctgagccctg ggaactatgt tgtggttgca cagacacgga gaaaatcagc ggagttcttg ctccgaatct tcctgaaaat gccagacagt gacaggcacc tgagcagcca tttcaacctc agaatgaagg gaagcccttc agaacatggc tcccaacaaa gcattttcaa cagatatgct cagcagaggc tggacattga tgccacccag cttcagggcc ttctcaacca ggagcttcta acaggacctc caggggacat gttctcctta gatgagtgcc gcagcttggt ggctctgatg gaactgaaag tgaatgggcg gctagaccaa gaggagtttg cgcgactgtg gaagcgcctt gttcactacc agcatgtttt ccagaaggtt cagacaagcc ctggagtcct cctgagctcg gacttgtgga aggccataga gaatacagac ttcctcagag ggatcttcat cagccgtgag ctgctgcatc tggtgaccct caggtacagc gacagcgtcg gcagggtcag cttccccagc ctggtctgct tcctgatgcg gcttgaagcc atggcaaaga ccttccgcaa cctctctaag gatggaaaag gactctacct gacagaaatg gagtggatga gcctggtcat gtacaactga. It is sometimes possible for the material contained within the vial of "CAPN13, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.