CAPN11 cdna clone
CAPN11 cDNA Clone
Gene Names
CAPN11; calpain11
Synonyms
CAPN11; CAPN11 cDNA Clone; CAPN11 cdna clone
Sequence
atggtggctcacataaacaacagccggctcaaggccaagggcgtgggccagcacgacaacgcccagaactttggtaaccagagctttgaggagctgcgagcagcctgtctaagaaagggggagctcttcgaggaccccttattccctgctgaacccagctcactgggcttcaaggacctgggccccaactccaaaaatgtgcagaacatctcctggcagcggcccaaggatatcataaacaaccctctattcatcatggatgggatttctccaacagacatctgccaggggatcctcggggactgctggctgctggctgccatcggctcccttaccacctgccccaaactgctataccgcgtggtgcccagaggacagagcttcaagaaaaactatgctggcatcttccattttcagatttggcagtttggacagtgggtgaacgtggtggtagatgaccggctgcccacaaagaatgacaagctggtgtttgtgcactcaaccgaacgcagtgagttctggagtgccctgctggagaaggcgtatgccaagctgagtgggtcctatgaagcattgtcagggggcagtaccatggagggccttgaggacttcacaggaggcgtggcccagagcttccaactccagaggccccctcagaacctgctcaggctccttaggaaggccgtggagcgatcctccctcatgggttgctccattgaagtcaccagtgatagtgaactggaatccatgactgacaagatgctggtgagagggcacgcttactctgtgactggccttcaggatgtccactacagaggcaaaatggaaacactgattcgggtccggaatccctggggccggattgagtggaatggagcttggagtgacagtgccagggagtgggaagaggtggcctcagacatccagatgcagctgctgcacaagacggaggacggggagttctggatgtcctaccaagatttcctgaacaacttcacgctcctggagatctgcaacctcacgcctgatacactctctggggactacaagagctactggcacaccaccttctacgagggcagctggcgcagaggcagctccgcagggggctgcaggaaccaccctggcacgttctggaccaacccccagtttaagatctctcttcctgagggggatgacccagaggatgacgcagagggcaatgttgtggcctgcacctgcctggtggccctaatgcagaagaactggcggcatgcacggcagcagggagcccagctgcagaccattggctttgtcctctacgcggtcccaaaagagtttcagaacattcaggatgtccacttgaagaaggaattcttcacgaagtatcaggaccacggcttctcagagatcttcaccaactcacgggaggtgagcagccaactccggctgcctccgggggaatatatcattattccctccacctttgagccacacagagatgctgacttcctgcttcgggtcttcaccgagaagcacagcgagtcatgggaattggatgaagtcaactatgctgagcaactccaagaggaaaaggtctctgaggatgacatggaccaggacttcctacatttgtttaagatagtggcaggagagggcaaggagataggggtgtatgagctccagaggctgctcaacaggatggccatcaaattcaaaagcttcaagaccaagggctttggcctggatgcttgccgctgcatgatcaacctcatggataaagatggctctggcaagctggggcttctagagttcaagatcctgtggaaaaaactcaagaaatggatggacatcttcagagagtgtgaccaggaccattcaggcaccttgaactcctatgagatgcgcctggttattgagaaagcaggcatcaagctgaacaacaaggtaatgcaggtcctggtggccaggtatgcagatgatgacctgatcatagactttgacagcttcatcagctgtttcctgaggctaaagaccatgttcacattctttctaaccatggaccccaagaatactggccatatttgcttgagcctggaacagtggctgcagatgaccatgtggggatag
Sequence Length
2109
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
84,423 Da
NCBI Official Full Name
Homo sapiens calpain 11, mRNA
NCBI Official Synonym Full Names
calpain 11
NCBI Official Symbol
CAPN11
NCBI Official Synonym Symbols
calpain11
NCBI Protein Information
calpain-11
UniProt Protein Name
Calpain-11
Protein Family
UniProt Gene Name
CAPN11
UniProt Synonym Gene Names
CANP 11
UniProt Entry Name
CAN11_HUMAN
NCBI Description
Calpains constitute a family of intracellular calcium-dependent cysteine proteases. There are eight members in this superfamily. They consist of a variable 80 kDa subunit and an invariant 30 kDa subunit. This calpain protein appears to have protease activity and calcium-binding ability. A similar mouse protein may play a functional role in spermatogenesis and in the regulation of calcium-dependent signal transduction events during meiosis. [provided by RefSeq, Dec 2008]
Uniprot Description
CAPN11: Calcium-regulated non-lysosomal thiol-protease which catalyzes limited proteolysis of substrates involved in cytoskeletal remodeling and signal transduction. Belongs to the peptidase C2 family.
Protein type: Protease; EC 3.4.22.-
Chromosomal Location of Human Ortholog: 6p12
Cellular Component: cytoplasm
Molecular Function: peptidase activity
Research Articles on CAPN11
Similar Products
Product Notes
The CAPN11 capn11 (Catalog #AAA1278380) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtggctc acataaacaa cagccggctc aaggccaagg gcgtgggcca gcacgacaac gcccagaact ttggtaacca gagctttgag gagctgcgag cagcctgtct aagaaagggg gagctcttcg aggacccctt attccctgct gaacccagct cactgggctt caaggacctg ggccccaact ccaaaaatgt gcagaacatc tcctggcagc ggcccaagga tatcataaac aaccctctat tcatcatgga tgggatttct ccaacagaca tctgccaggg gatcctcggg gactgctggc tgctggctgc catcggctcc cttaccacct gccccaaact gctataccgc gtggtgccca gaggacagag cttcaagaaa aactatgctg gcatcttcca ttttcagatt tggcagtttg gacagtgggt gaacgtggtg gtagatgacc ggctgcccac aaagaatgac aagctggtgt ttgtgcactc aaccgaacgc agtgagttct ggagtgccct gctggagaag gcgtatgcca agctgagtgg gtcctatgaa gcattgtcag ggggcagtac catggagggc cttgaggact tcacaggagg cgtggcccag agcttccaac tccagaggcc ccctcagaac ctgctcaggc tccttaggaa ggccgtggag cgatcctccc tcatgggttg ctccattgaa gtcaccagtg atagtgaact ggaatccatg actgacaaga tgctggtgag agggcacgct tactctgtga ctggccttca ggatgtccac tacagaggca aaatggaaac actgattcgg gtccggaatc cctggggccg gattgagtgg aatggagctt ggagtgacag tgccagggag tgggaagagg tggcctcaga catccagatg cagctgctgc acaagacgga ggacggggag ttctggatgt cctaccaaga tttcctgaac aacttcacgc tcctggagat ctgcaacctc acgcctgata cactctctgg ggactacaag agctactggc acaccacctt ctacgagggc agctggcgca gaggcagctc cgcagggggc tgcaggaacc accctggcac gttctggacc aacccccagt ttaagatctc tcttcctgag ggggatgacc cagaggatga cgcagagggc aatgttgtgg cctgcacctg cctggtggcc ctaatgcaga agaactggcg gcatgcacgg cagcagggag cccagctgca gaccattggc tttgtcctct acgcggtccc aaaagagttt cagaacattc aggatgtcca cttgaagaag gaattcttca cgaagtatca ggaccacggc ttctcagaga tcttcaccaa ctcacgggag gtgagcagcc aactccggct gcctccgggg gaatatatca ttattccctc cacctttgag ccacacagag atgctgactt cctgcttcgg gtcttcaccg agaagcacag cgagtcatgg gaattggatg aagtcaacta tgctgagcaa ctccaagagg aaaaggtctc tgaggatgac atggaccagg acttcctaca tttgtttaag atagtggcag gagagggcaa ggagataggg gtgtatgagc tccagaggct gctcaacagg atggccatca aattcaaaag cttcaagacc aagggctttg gcctggatgc ttgccgctgc atgatcaacc tcatggataa agatggctct ggcaagctgg ggcttctaga gttcaagatc ctgtggaaaa aactcaagaa atggatggac atcttcagag agtgtgacca ggaccattca ggcaccttga actcctatga gatgcgcctg gttattgaga aagcaggcat caagctgaac aacaaggtaa tgcaggtcct ggtggccagg tatgcagatg atgacctgat catagacttt gacagcttca tcagctgttt cctgaggcta aagaccatgt tcacattctt tctaaccatg gaccccaaga atactggcca tatttgcttg agcctggaac agtggctgca gatgaccatg tggggatag. It is sometimes possible for the material contained within the vial of "CAPN11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
