Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

CAPN1 cdna clone

CAPN1 cDNA Clone

Gene Names
CAPN1; CANP; muCL; CANP1; SPG76; CANPL1; muCANP
Synonyms
CAPN1; CAPN1 cDNA Clone; CAPN1 cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
atgtcggaggagatcatcacgccggtgtactgcactggggtgtcagcccaagtgcagaagcagcgggccagggagctgggcctgggccgccatgagaatgccatcaagtacctgggccaggattatgagcagctgcgggtgcgatgcctgcagagtgggaccctcttccgtgatgaggccttccccccggtaccccagagcctgggttacaaggacctgggtcccaattcctccaagacctatggcatcaagtggaagcgtcccacggaactgctgtcaaacccccagttcattgtggatggagctacccgcacagacatctgccagggagcactgggggactgctggctcttggcggccatcgcctccctcactctcaacgacaccctcctgcaccgagtggttccgcacggccagagcttccagaatggctatgccggcatcttccatttccagctgtggcaatttggggagtgggtggacgtggtcgtggatgacctgctgcccatcaaggacgggaagctagtgttcgtgcactctgccgaaggcaacgagttctggagcgccctgcttgagaaggcctatgccaaggtaaatggcagctacgaggccctgtcagggggcagcacctcagagggctttgaggacttcacaggcggggttaccgagtggtacgagttgcgcaaggctcccagtgacctctaccagatcatcctcaaggcgctggagcggggctccctgctgggctgctccatagacatctccagcgttctagacatggaggccatcactttcaagaagttggtgaagggccatgcctactctgtgaccggggccaagcaggtgaactaccgaggccaggtggtgagcctgatccggatgcggaacccctggggcgaggtggagtggacgggagcctggagcgacagctcctcagagtggaacaacgtggacccatatgaacgggaccagctccgggtcaagatggaggacggggagttctggatgtcattccgagacttcatgcgggagttcacccgcctggagatctgcaacctcacacccgacgccctcaagagccggaccatccgcaaatggaacaccacactctacgaaggcacctggcggcgggggagcaccgcggggggctgccgaaactacccagccaccttctgggtgaaccctcagttcaagatccggctggatgagacggatgacccggacgactacggggaccgcgagtcaggctgcagcttcgtgctcgcccttatgcagaagcaccgtcgccgcgagcgccgcttcggccgcgacatggagactattggcttcgcggtctacgaggtccctccggagctggtgggccagccggccgtacacttgaagcgtgacttcttcctggccaatgcgtctcgggcgcgctcagagcagttcatcaacctgcgagaggtcagcacccgcttccgcctgccacccggggagtatgtggtggtgccctccaccttcgagcccaacaaggagggcgacttcgtgctgcgcttcttctcagagaagagtgctgggactgtggagctggatgaccagatccaggccaatctccccgatgagcaagtgctctcagaagaggagattgacgagaacttcaaggccctcttcaggcagctggcaggggaggacatggagatcagcgtgaaggagttgcggacaatcctcaataggatcatcagcaaacacaaagacctgcggaccaagggcttcagcctagagtcgtgccgcagcatggtgaacctcatggatcgtgatggcaatgggaagctgggcctggtggagttcaacatcctgtggaaccgcatccggaattacctgtccatcttccggaagtttgacctggacaagtcgggcagcatgagtgcctacgagatgcggatggccattgagtcggcaggcttcaagctcaacaagaagctgtacgagctcatcatcacccgctactcggagcccgacctggcggtcgactttgacaatttcgtttgctgcctggtgcggctagagaccatgttccgatttttcaaaactctggacacagatctggatggagttgtgacctttgacttgtttaagtggttgcagctgaccatgtttgcatga
Sequence Length
2145
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
823
Molecular Weight
81,890 Da
NCBI Official Full Name
Homo sapiens calpain 1, (mu/I) large subunit, mRNA
NCBI Official Synonym Full Names
calpain 1
NCBI Official Symbol
CAPN1
NCBI Official Synonym Symbols
CANP; muCL; CANP1; SPG76; CANPL1; muCANP
NCBI Protein Information
calpain-1 catalytic subunit
UniProt Protein Name
Calpain-1 catalytic subunit
Protein Family
UniProt Gene Name
CAPN1
UniProt Synonym Gene Names
CANPL1; CANP 1; muCANP
UniProt Entry Name
CAN1_HUMAN

NCBI Description

The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes the large subunit of the ubiquitous enzyme, calpain 1. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]

Uniprot Description

CAPN1: Calcium-regulated non-lysosomal thiol-protease which catalyze limited proteolysis of substrates involved in cytoskeletal remodeling and signal transduction. Forms a heterodimer with a small (regulatory) subunit (CAPNS1). Ubiquitous. Activated by micromolar concentrations of calcium and inhibited by calpastatin. Belongs to the peptidase C2 family.

Protein type: Motility/polarity/chemotaxis; EC 3.4.22.52; Protease

Chromosomal Location of Human Ortholog: 11q13

Cellular Component: cytoplasm; cytosol; focal adhesion; membrane; plasma membrane

Molecular Function: calcium-dependent cysteine-type endopeptidase activity; protein binding

Biological Process: extracellular matrix disassembly; positive regulation of cell proliferation; proteolysis

Disease: Spastic Paraplegia 76, Autosomal Recessive

Research Articles on CAPN1

Similar Products

Product Notes

The CAPN1 capn1 (Catalog #AAA1278036) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcggagg agatcatcac gccggtgtac tgcactgggg tgtcagccca agtgcagaag cagcgggcca gggagctggg cctgggccgc catgagaatg ccatcaagta cctgggccag gattatgagc agctgcgggt gcgatgcctg cagagtggga ccctcttccg tgatgaggcc ttccccccgg taccccagag cctgggttac aaggacctgg gtcccaattc ctccaagacc tatggcatca agtggaagcg tcccacggaa ctgctgtcaa acccccagtt cattgtggat ggagctaccc gcacagacat ctgccaggga gcactggggg actgctggct cttggcggcc atcgcctccc tcactctcaa cgacaccctc ctgcaccgag tggttccgca cggccagagc ttccagaatg gctatgccgg catcttccat ttccagctgt ggcaatttgg ggagtgggtg gacgtggtcg tggatgacct gctgcccatc aaggacggga agctagtgtt cgtgcactct gccgaaggca acgagttctg gagcgccctg cttgagaagg cctatgccaa ggtaaatggc agctacgagg ccctgtcagg gggcagcacc tcagagggct ttgaggactt cacaggcggg gttaccgagt ggtacgagtt gcgcaaggct cccagtgacc tctaccagat catcctcaag gcgctggagc ggggctccct gctgggctgc tccatagaca tctccagcgt tctagacatg gaggccatca ctttcaagaa gttggtgaag ggccatgcct actctgtgac cggggccaag caggtgaact accgaggcca ggtggtgagc ctgatccgga tgcggaaccc ctggggcgag gtggagtgga cgggagcctg gagcgacagc tcctcagagt ggaacaacgt ggacccatat gaacgggacc agctccgggt caagatggag gacggggagt tctggatgtc attccgagac ttcatgcggg agttcacccg cctggagatc tgcaacctca cacccgacgc cctcaagagc cggaccatcc gcaaatggaa caccacactc tacgaaggca cctggcggcg ggggagcacc gcggggggct gccgaaacta cccagccacc ttctgggtga accctcagtt caagatccgg ctggatgaga cggatgaccc ggacgactac ggggaccgcg agtcaggctg cagcttcgtg ctcgccctta tgcagaagca ccgtcgccgc gagcgccgct tcggccgcga catggagact attggcttcg cggtctacga ggtccctccg gagctggtgg gccagccggc cgtacacttg aagcgtgact tcttcctggc caatgcgtct cgggcgcgct cagagcagtt catcaacctg cgagaggtca gcacccgctt ccgcctgcca cccggggagt atgtggtggt gccctccacc ttcgagccca acaaggaggg cgacttcgtg ctgcgcttct tctcagagaa gagtgctggg actgtggagc tggatgacca gatccaggcc aatctccccg atgagcaagt gctctcagaa gaggagattg acgagaactt caaggccctc ttcaggcagc tggcagggga ggacatggag atcagcgtga aggagttgcg gacaatcctc aataggatca tcagcaaaca caaagacctg cggaccaagg gcttcagcct agagtcgtgc cgcagcatgg tgaacctcat ggatcgtgat ggcaatggga agctgggcct ggtggagttc aacatcctgt ggaaccgcat ccggaattac ctgtccatct tccggaagtt tgacctggac aagtcgggca gcatgagtgc ctacgagatg cggatggcca ttgagtcggc aggcttcaag ctcaacaaga agctgtacga gctcatcatc acccgctact cggagcccga cctggcggtc gactttgaca atttcgtttg ctgcctggtg cggctagaga ccatgttccg atttttcaaa actctggaca cagatctgga tggagttgtg acctttgact tgtttaagtg gttgcagctg accatgtttg catga. It is sometimes possible for the material contained within the vial of "CAPN1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.
Looking for a specific manual?
Request a Manual