Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CAPG cdna clone

CAPG cDNA Clone

Gene Names
CAPG; MCP; AFCP; HEL-S-66
Synonyms
CAPG; CAPG cDNA Clone; CAPG cdna clone
Ordering
For Research Use Only!
Sequence
atgtacacagccattccccagagtggctctccattcccaggctcagtgcaggatccaggcctgcatgtgtggcgggtggagaagctgaagccggtgcctgtggcgcaagagaaccagggcgtcttcttctcgggggactcctacctagtgctgcacaatggcccagaagaggtttcccatctgcacctgtggataggccagcagtcatcccgggatgagcagggggcctgtgccgtgctggctgtgcacctcaacacgctgctgggagagcggcctgtgcagcaccgcgaggtgcagggcaatgagtctgacctcttcatgagctacttcccacggggcctcaagtaccaggaaggtggtgtggagtcagcatttcacaagacctccacaggagccccagctgccatcaagaaactctaccaggtgaaggggaagaagaacatccgtgccaccgagcgggcactgaactgggacagcttcaacactggggactgcttcatcctggacctgggccagaacatcttcgcctggtgtggtggaaagtccaacatcctggaacgcaacaaggcgagggacctggccctggccatccgggacagtgagcgacagggcaaggcccaggtggagattgtcactgatggggaggagcctgctgagatgatccaggtcctgggccccaagcctgctctgaaggagggcaaccctgaggaagacctcacagctgacaaggcaaatgcccaggccgcagctctgtataaggtctctgatgccactggacagatgaacctgaccaaggtggctgactccagcccatttgcccttgaactgctgatatctgatgactgctttgtgctggacaacgggctctgtggcaagatctatatctggaaggggcgaaaagcgaatgagaaggagcggcaggcagccctgcaggtggccgagggcttcatctcgcgcatgcagtacgccccgaacactcaggtggagattctgcctcagggccgtgagagtcccatcttcaagcaatttttcaaggactggaaatga
Sequence Length
1047
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
822
Molecular Weight
36,857 Da
NCBI Official Full Name
Homo sapiens capping protein (actin filament), gelsolin-like, mRNA
NCBI Official Synonym Full Names
capping actin protein, gelsolin like
NCBI Official Symbol
CAPG
NCBI Official Synonym Symbols
MCP; AFCP; HEL-S-66
NCBI Protein Information
macrophage-capping protein
UniProt Protein Name
Macrophage-capping protein
Protein Family
UniProt Gene Name
CAPG
UniProt Synonym Gene Names
AFCP; MCP
UniProt Entry Name
CAPG_HUMAN

NCBI Description

This gene encodes a member of the gelsolin/villin family of actin-regulatory proteins. The encoded protein reversibly blocks the barbed ends of F-actin filaments in a Ca2+ and phosphoinositide-regulated manner, but does not sever preformed actin filaments. By capping the barbed ends of actin filaments, the encoded protein contributes to the control of actin-based motility in non-muscle cells. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jan 2012]

Uniprot Description

CAPG: Calcium-sensitive protein which reversibly blocks the barbed ends of actin filaments but does not sever preformed actin filaments. May play an important role in macrophage function. May play a role in regulating cytoplasmic and/or nuclear structures through potential interactions with actin. May bind DNA. Belongs to the villin/gelsolin family.

Protein type: Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 2p11.2

Cellular Component: cell-cell adherens junction; centriole; cytoplasm; F-actin capping protein complex; nucleolus; nucleoplasm; nucleus

Molecular Function: protein binding; protein complex binding; protein domain specific binding

Biological Process: extracellular matrix disassembly

Research Articles on CAPG

Similar Products

Product Notes

The CAPG capg (Catalog #AAA1267902) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtacacag ccattcccca gagtggctct ccattcccag gctcagtgca ggatccaggc ctgcatgtgt ggcgggtgga gaagctgaag ccggtgcctg tggcgcaaga gaaccagggc gtcttcttct cgggggactc ctacctagtg ctgcacaatg gcccagaaga ggtttcccat ctgcacctgt ggataggcca gcagtcatcc cgggatgagc agggggcctg tgccgtgctg gctgtgcacc tcaacacgct gctgggagag cggcctgtgc agcaccgcga ggtgcagggc aatgagtctg acctcttcat gagctacttc ccacggggcc tcaagtacca ggaaggtggt gtggagtcag catttcacaa gacctccaca ggagccccag ctgccatcaa gaaactctac caggtgaagg ggaagaagaa catccgtgcc accgagcggg cactgaactg ggacagcttc aacactgggg actgcttcat cctggacctg ggccagaaca tcttcgcctg gtgtggtgga aagtccaaca tcctggaacg caacaaggcg agggacctgg ccctggccat ccgggacagt gagcgacagg gcaaggccca ggtggagatt gtcactgatg gggaggagcc tgctgagatg atccaggtcc tgggccccaa gcctgctctg aaggagggca accctgagga agacctcaca gctgacaagg caaatgccca ggccgcagct ctgtataagg tctctgatgc cactggacag atgaacctga ccaaggtggc tgactccagc ccatttgccc ttgaactgct gatatctgat gactgctttg tgctggacaa cgggctctgt ggcaagatct atatctggaa ggggcgaaaa gcgaatgaga aggagcggca ggcagccctg caggtggccg agggcttcat ctcgcgcatg cagtacgccc cgaacactca ggtggagatt ctgcctcagg gccgtgagag tcccatcttc aagcaatttt tcaaggactg gaaatga. It is sometimes possible for the material contained within the vial of "CAPG, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.