Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CANX cdna clone

CANX cDNA Clone

Gene Names
CANX; CNX; P90; IP90
Synonyms
CANX; CANX cDNA Clone; CANX cdna clone
Ordering
For Research Use Only!
Sequence
atggaagggaagtggttgctgtgtatgttactggtgcttggaactgctattgttgaggctcatgatggacatgatgatgatgtgattgatattgaggatgaccttgacgatgtcattgaagaggtagaagactcaaaaccagataccactgctcctccttcatctcccaaggttacttacaaagctccagttccaacaggggaagtatattttgctgattcttttgacagaggaactctgtcagggtggattttatccaaagccaagaaagacgataccgatgatgaaattgccaaatatgatggaaagtgggaggtagaggaaatgaaggagtcaaagcttccaggtgataaaggacttgtgttgatgtctcgggccaagcatcatgccatctctgctaaactgaacaagcccttcctgtttgacaccaagcctctcattgttcagtatgaggttaatttccaaaatggaatagaatgtggtggtgcctatgtgaaactgctttctaaaacaccagaactcaacctggatcagttccatgacaagaccccttatacgattatgtttggtccagataaatgtggagaggactataaactgcacttcatcttccgacacaaaaaccccaaaacgggtatctatgaagaaaaacatgctaagaggccagatgcagatctgaagacctattttactgataagaaaacacatctttacacactaatcttgaatccagataatagttttgaaatactggttgaccaatctgtggtgaatagtggaaatctgctcaatgacatgactcctcctgtaaatccttcacgtgaaattgaggacccagaagaccggaagcccgaggattgggatgaaagaccaaaaatcccagatccagaagctgtcaagccagatgactgggatgaagatgcccctgctaagattccagatgaagaggccacaaaacccgaaggctggttagatgatgagcctgagtacgtacctgatccagacgcagagaaacctgaggattgggatgaagacatggatggagaatgggaggctcctcagattgccaaccctagatgtgagtcagctcctggatgtggtgtctggcagcgacctgtgattgacaaccccaattataaaggcaaatggaagcctcctatgattgacaatcccagttaccagggaatctggaaacccaggaaaataccaaatccagatttctttgaagatctggaacctttcagaatgactccttttagtgctattggtttggagctgtggtccatgacctctgacattttttttgacaactttatcatttgtgctgatcgaagaatagttgatgattgggccaatgatggatggggcctgaagaaagctgctgatggggctgctgagccaggcgttgtggggcagatgatcgaggcagctgaagagcgcccgtggctgtgggtagtctatattctaactgtagcccttcctgtgttcctggttatcctcttctgctgttctggaaagaaacagaccagtggtatggagtataagaaaactgatgcacctcaaccggatgtgaaggaagaggaagaagagaaggaagaggaaaaggacaagggagatgaggaggaggaaggagaagagaaacttgaagagaaacagaaaagtgatgctgaagaagatggtggcactgtcagtcaagaggaggaagacagaaaacctaaagcagaggaggatgaaattttgaacagatcaccaagaaacagaaagccacgaagagagtga
Sequence Length
1779
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
821
Molecular Weight
55,598 Da
NCBI Official Full Name
Homo sapiens calnexin, mRNA
NCBI Official Synonym Full Names
calnexin
NCBI Official Symbol
CANX
NCBI Official Synonym Symbols
CNX; P90; IP90
NCBI Protein Information
calnexin
UniProt Protein Name
Calnexin
UniProt Gene Name
CANX
UniProt Entry Name
CALX_HUMAN

NCBI Description

This gene encodes a member of the calnexin family of molecular chaperones. The encoded protein is a calcium-binding, endoplasmic reticulum (ER)-associated protein that interacts transiently with newly synthesized N-linked glycoproteins, facilitating protein folding and assembly. It may also play a central role in the quality control of protein folding by retaining incorrectly folded protein subunits within the ER for degradation. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]

Uniprot Description

Calnexin: a calcium-binding protein of the calreticulin family. A type I membrane protein of the endoplasmic reticulum .Interacts with newly synthesized glycoproteins in the endoplasmic reticulum. May act in assisting protein assembly and/or in the retention within the ER of unassembled protein subunits. It seems to play a major role in the quality control apparatus of the ER by the retention of incorrectly folded proteins.

Protein type: Endoplasmic reticulum; Membrane protein, integral; Calcium-binding; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 5q35

Cellular Component: endoplasmic reticulum; endoplasmic reticulum lumen; endoplasmic reticulum membrane; extracellular matrix; membrane

Molecular Function: protein binding

Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class II; antigen processing and presentation of peptide antigen via MHC class I; protein folding; protein secretion; synaptic vesicle endocytosis

Research Articles on CANX

Similar Products

Product Notes

The CANX canx (Catalog #AAA1266892) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaggga agtggttgct gtgtatgtta ctggtgcttg gaactgctat tgttgaggct catgatggac atgatgatga tgtgattgat attgaggatg accttgacga tgtcattgaa gaggtagaag actcaaaacc agataccact gctcctcctt catctcccaa ggttacttac aaagctccag ttccaacagg ggaagtatat tttgctgatt cttttgacag aggaactctg tcagggtgga ttttatccaa agccaagaaa gacgataccg atgatgaaat tgccaaatat gatggaaagt gggaggtaga ggaaatgaag gagtcaaagc ttccaggtga taaaggactt gtgttgatgt ctcgggccaa gcatcatgcc atctctgcta aactgaacaa gcccttcctg tttgacacca agcctctcat tgttcagtat gaggttaatt tccaaaatgg aatagaatgt ggtggtgcct atgtgaaact gctttctaaa acaccagaac tcaacctgga tcagttccat gacaagaccc cttatacgat tatgtttggt ccagataaat gtggagagga ctataaactg cacttcatct tccgacacaa aaaccccaaa acgggtatct atgaagaaaa acatgctaag aggccagatg cagatctgaa gacctatttt actgataaga aaacacatct ttacacacta atcttgaatc cagataatag ttttgaaata ctggttgacc aatctgtggt gaatagtgga aatctgctca atgacatgac tcctcctgta aatccttcac gtgaaattga ggacccagaa gaccggaagc ccgaggattg ggatgaaaga ccaaaaatcc cagatccaga agctgtcaag ccagatgact gggatgaaga tgcccctgct aagattccag atgaagaggc cacaaaaccc gaaggctggt tagatgatga gcctgagtac gtacctgatc cagacgcaga gaaacctgag gattgggatg aagacatgga tggagaatgg gaggctcctc agattgccaa ccctagatgt gagtcagctc ctggatgtgg tgtctggcag cgacctgtga ttgacaaccc caattataaa ggcaaatgga agcctcctat gattgacaat cccagttacc agggaatctg gaaacccagg aaaataccaa atccagattt ctttgaagat ctggaacctt tcagaatgac tccttttagt gctattggtt tggagctgtg gtccatgacc tctgacattt tttttgacaa ctttatcatt tgtgctgatc gaagaatagt tgatgattgg gccaatgatg gatggggcct gaagaaagct gctgatgggg ctgctgagcc aggcgttgtg gggcagatga tcgaggcagc tgaagagcgc ccgtggctgt gggtagtcta tattctaact gtagcccttc ctgtgttcct ggttatcctc ttctgctgtt ctggaaagaa acagaccagt ggtatggagt ataagaaaac tgatgcacct caaccggatg tgaaggaaga ggaagaagag aaggaagagg aaaaggacaa gggagatgag gaggaggaag gagaagagaa acttgaagag aaacagaaaa gtgatgctga agaagatggt ggcactgtca gtcaagagga ggaagacaga aaacctaaag cagaggagga tgaaattttg aacagatcac caagaaacag aaagccacga agagagtga. It is sometimes possible for the material contained within the vial of "CANX, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.