Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CANT1 cdna clone

CANT1 cDNA Clone

Gene Names
CANT1; DBQD; DBQD1; SCAN1; SHAPY; SCAN-1
Synonyms
CANT1; CANT1 cDNA Clone; CANT1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcccgtgcagctgtctgagcacccggaatggaatgagtctatgcactccctccggatcagtgtggggggccttcctgtgctggcgtccatgaccaaggccgcggacccccgcttccgcccccgctggaaggtgatcctgacgttctttgtgggtgctgccatcctctggctgctctgctcccaccgcccggcccccggcaggccccccacccacaatgcacacaactggaggctcggccaggcgcccgccaactggtacaatgacacctaccccctgtctcccccacaaaggacaccggctgggattcggtatcgaatcgcagttatcgcagacctggacacagagtcaagggcccaagaggaaaacacctggttcagttacctgaaaaagggctacctgaccctgtcagacagtggggacaaggtggccgtggaatgggacaaagaccatggggtcctggagtcccacctggcggagaaggggagaggcatggagctatccgacctgattgttttcaatgggaaactctactccgtggatgaccggacgggggtcgtctaccagatcgaaggcagcaaagccgtgccctgggtgattctgtccgacggcgacggcaccgtggagaaaggcttcaaggccgaatggctggcagtgaaggacgagcgtctgtacgtgggcggcctgggcaaggagtggacgaccactacgggtgatgtggtgaacgagaacccggagtgggtgaaggtggtgggctacaagggcagcgtggaccacgagaactgggtgtccaactacaacgccctgcgggctgctgccggcatccagccgccaggctacctcatccatgagtctgcctgctggagtgacacgctgcagcgctggttcttcctgccgcgccgcgccagccaggagcgctacagcgagaaggacgacgagcgcaagggcgccaacctgctgctgagcgcctcccctgacttcggcgacatcgctgtgagccacgtcggggcggtggtccccactcacggcttctcgtccttcaagttcatccccaacaccgacgaccagatcattgtggccctcaaatccgaggaggacagcggcagagtcgcctcctacatcatggccttcacgctggacgggcgcttcctgttgccggagaccaagatcggaagcgtgaaatacgaaggcatcgagttcatttaa
Sequence Length
1206
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,946 Da
NCBI Official Full Name
Homo sapiens calcium activated nucleotidase 1, mRNA
NCBI Official Synonym Full Names
calcium activated nucleotidase 1
NCBI Official Symbol
CANT1
NCBI Official Synonym Symbols
DBQD; DBQD1; SCAN1; SHAPY; SCAN-1
NCBI Protein Information
soluble calcium-activated nucleotidase 1
UniProt Protein Name
Soluble calcium-activated nucleotidase 1
UniProt Gene Name
CANT1
UniProt Synonym Gene Names
SHAPY; SCAN-1
UniProt Entry Name
CANT1_HUMAN

NCBI Description

This protein encoded by this gene belongs to the apyrase family. It functions as a calcium-dependent nucleotidase with a preference for UDP. Mutations in this gene are associated with Desbuquois dysplasia with hand anomalies. Alternatively spliced transcript variants have been noted for this gene.[provided by RefSeq, Mar 2010]

Uniprot Description

CANT1: Calcium-dependent nucleotidase with a preference for UDP. The order of activity with different substrates is UDP > GDP > UTP > GTP. Has very low activity towards ADP and even lower activity towards ATP. Does not hydrolyze AMP and GMP. Involved in proteoglycan synthesis. Defects in CANT1 are the cause of Desbuquois dysplasia (DBQD). A chondrodysplasia characterized by severe prenatal and postnatal growth retardation (less than -5 SD), joint laxity, short extremities, progressive scoliosis, round face, midface hypoplasia, prominent bulging eyes. The main radiologic features are short long bones with metaphyseal splay, a 'Swedish key' appearance of the proximal femur (exaggerated trochanter), and advance carpal and tarsal bone age. Two forms of Desbuquois dysplasia are distinguished on the basis of the presence (type 1) or absence (type 2) of characteristic hand anomalies: an extra ossification center distal to the second metacarpal, delta phalanx, bifid distal thumb phalanx, and phalangeal dislocations. Belongs to the apyrase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Nucleotide Metabolism - pyrimidine; Hydrolase; Membrane protein, integral; Nucleotide Metabolism - purine; Endoplasmic reticulum; EC 3.6.1.6

Chromosomal Location of Human Ortholog: 17q25.3

Molecular Function: guanosine-diphosphatase activity; signal transducer activity; uridine-diphosphatase activity

Biological Process: positive regulation of I-kappaB kinase/NF-kappaB cascade; proteoglycan biosynthetic process

Disease: Desbuquois Dysplasia 1

Research Articles on CANT1

Similar Products

Product Notes

The CANT1 cant1 (Catalog #AAA1278193) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccgtgc agctgtctga gcacccggaa tggaatgagt ctatgcactc cctccggatc agtgtggggg gccttcctgt gctggcgtcc atgaccaagg ccgcggaccc ccgcttccgc ccccgctgga aggtgatcct gacgttcttt gtgggtgctg ccatcctctg gctgctctgc tcccaccgcc cggcccccgg caggcccccc acccacaatg cacacaactg gaggctcggc caggcgcccg ccaactggta caatgacacc taccccctgt ctcccccaca aaggacaccg gctgggattc ggtatcgaat cgcagttatc gcagacctgg acacagagtc aagggcccaa gaggaaaaca cctggttcag ttacctgaaa aagggctacc tgaccctgtc agacagtggg gacaaggtgg ccgtggaatg ggacaaagac catggggtcc tggagtccca cctggcggag aaggggagag gcatggagct atccgacctg attgttttca atgggaaact ctactccgtg gatgaccgga cgggggtcgt ctaccagatc gaaggcagca aagccgtgcc ctgggtgatt ctgtccgacg gcgacggcac cgtggagaaa ggcttcaagg ccgaatggct ggcagtgaag gacgagcgtc tgtacgtggg cggcctgggc aaggagtgga cgaccactac gggtgatgtg gtgaacgaga acccggagtg ggtgaaggtg gtgggctaca agggcagcgt ggaccacgag aactgggtgt ccaactacaa cgccctgcgg gctgctgccg gcatccagcc gccaggctac ctcatccatg agtctgcctg ctggagtgac acgctgcagc gctggttctt cctgccgcgc cgcgccagcc aggagcgcta cagcgagaag gacgacgagc gcaagggcgc caacctgctg ctgagcgcct cccctgactt cggcgacatc gctgtgagcc acgtcggggc ggtggtcccc actcacggct tctcgtcctt caagttcatc cccaacaccg acgaccagat cattgtggcc ctcaaatccg aggaggacag cggcagagtc gcctcctaca tcatggcctt cacgctggac gggcgcttcc tgttgccgga gaccaagatc ggaagcgtga aatacgaagg catcgagttc atttaa. It is sometimes possible for the material contained within the vial of "CANT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.