Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CAMK4 cdna clone

CAMK4 cDNA Clone

Gene Names
CAMK4; caMK; CaMK IV; CaMK-GR
Synonyms
CAMK4; CAMK4 cDNA Clone; CAMK4 cdna clone
Ordering
For Research Use Only!
Sequence
atgctcaaagtcacggtgccctcctgctccgcctcgtcctgctcttcggtcaccgccagtgcggccccggggaccgcgagcctcgtcccggattactggatcgacggctccaacagggatgcgctgagcgatttcttcgaggtggagtcggagctgggacggggtgctacatccattgtgtacagatgcaaacagaaggggacccagaagccttatgctctcaaagtgttaaagaaaacagtggacaaaaaaatcgtaagaactgagataggagttcttcttcgcctctcacatccaaacattataaaacttaaagagatatttgaaacccctacagaaatcagtctggtcctagaactcgtcacaggaggagaactgtttgataggattgtggaaaagggatattacagtgagcgagatgctgcagatgccgttaaacaaatcctggaggcagttgcttatctacatgaaaatgggattgtccatcgtgatctcaaaccagagaatcttctttatgcaactccagccccagatgcaccactcaaaatcgctgattttggactctctaaaattgtggaacatcaagtgctcatgaagacagtatgtggaaccccagggtactgcgcacctgaaattcttagaggttgtgcctatggacctgaggtggacatgtggtctgtaggaataatcacctacatcttactttgtggatttgaaccattctatgatgaaagaggcgatcagttcatgttcaggagaattctgaattgtgaatattactttatctccccctggtgggatgaagtatctctaaatgccaaggacttggtcagaaaattaattgttttggatccaaagaaacggctgactacatttcaagctctccagcatccgtgggtcacaggtaaagcagccaattttgtacacatggataccgctcaaaagaagctccaagaattcaatgcccggcgtaagcttaaggcagcggtgaaggctgtggtggcctcttcccgcctgggaagtgccagcagcagccatggcagcatccaggagagccacaaggctagccgagacccttctccaatccaagatggcaacgaggacatgaaagctattccagaaggagagaaaattcaaggcgatggggcccaagccgcagttaagggggcacaggctgagctgatgaaggtgcaagccttagagaaagttaaaggtgcagatataaatgctgaagaggcccccaaaatggtgcccaaggcagtggaggatgggataaaggtggctgacctggaactagaggagggcctagcagaggagaagctgaagactgtggaggaggcagcagctcccagagaagggcaaggaagctctgctgtgggttttgaagttccacagcaagatgtgatcctgccagagtactaa
Sequence Length
1422
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
814
Molecular Weight
51,926 Da
NCBI Official Full Name
Homo sapiens calcium/calmodulin-dependent protein kinase IV, mRNA
NCBI Official Synonym Full Names
calcium/calmodulin dependent protein kinase IV
NCBI Official Symbol
CAMK4
NCBI Official Synonym Symbols
caMK; CaMK IV; CaMK-GR
NCBI Protein Information
calcium/calmodulin-dependent protein kinase type IV
UniProt Protein Name
Calcium/calmodulin-dependent protein kinase type IV
UniProt Gene Name
CAMK4
UniProt Synonym Gene Names
CAMK; CAMK-GR; CAMKIV; CaMK IV
UniProt Entry Name
KCC4_HUMAN

NCBI Description

The product of this gene belongs to the serine/threonine protein kinase family, and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. This enzyme is a multifunctional serine/threonine protein kinase with limited tissue distribution, that has been implicated in transcriptional regulation in lymphocytes, neurons and male germ cells. [provided by RefSeq, Jul 2008]

Uniprot Description

CAMK4: a protein kinase of the CAMK1 family. Implicated in transcriptional regulation in lymphocytes, neurons and male germ cells. Two alternatively sliced isoforms have been described.

Protein type: EC 2.7.11.17; Protein kinase, CAMK; Kinase, protein; Protein kinase, Ser/Thr (non-receptor); CAMK group; CAMK1 family

Chromosomal Location of Human Ortholog: 5q21.3

Cellular Component: cytoplasm; cytosol; nucleolus; nucleoplasm; nucleus

Molecular Function: calcium-dependent protein serine/threonine kinase activity; calmodulin binding; calmodulin-dependent protein kinase activity

Biological Process: long-term memory; myeloid dendritic cell cytokine production; myeloid dendritic cell differentiation; peptidyl-serine phosphorylation; positive regulation of transcription, DNA-dependent; protein amino acid autophosphorylation; protein amino acid phosphorylation; regulation of osteoclast differentiation; regulation of T cell differentiation in the thymus; signal transduction

Research Articles on CAMK4

Similar Products

Product Notes

The CAMK4 camk4 (Catalog #AAA1271207) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctcaaag tcacggtgcc ctcctgctcc gcctcgtcct gctcttcggt caccgccagt gcggccccgg ggaccgcgag cctcgtcccg gattactgga tcgacggctc caacagggat gcgctgagcg atttcttcga ggtggagtcg gagctgggac ggggtgctac atccattgtg tacagatgca aacagaaggg gacccagaag ccttatgctc tcaaagtgtt aaagaaaaca gtggacaaaa aaatcgtaag aactgagata ggagttcttc ttcgcctctc acatccaaac attataaaac ttaaagagat atttgaaacc cctacagaaa tcagtctggt cctagaactc gtcacaggag gagaactgtt tgataggatt gtggaaaagg gatattacag tgagcgagat gctgcagatg ccgttaaaca aatcctggag gcagttgctt atctacatga aaatgggatt gtccatcgtg atctcaaacc agagaatctt ctttatgcaa ctccagcccc agatgcacca ctcaaaatcg ctgattttgg actctctaaa attgtggaac atcaagtgct catgaagaca gtatgtggaa ccccagggta ctgcgcacct gaaattctta gaggttgtgc ctatggacct gaggtggaca tgtggtctgt aggaataatc acctacatct tactttgtgg atttgaacca ttctatgatg aaagaggcga tcagttcatg ttcaggagaa ttctgaattg tgaatattac tttatctccc cctggtggga tgaagtatct ctaaatgcca aggacttggt cagaaaatta attgttttgg atccaaagaa acggctgact acatttcaag ctctccagca tccgtgggtc acaggtaaag cagccaattt tgtacacatg gataccgctc aaaagaagct ccaagaattc aatgcccggc gtaagcttaa ggcagcggtg aaggctgtgg tggcctcttc ccgcctggga agtgccagca gcagccatgg cagcatccag gagagccaca aggctagccg agacccttct ccaatccaag atggcaacga ggacatgaaa gctattccag aaggagagaa aattcaaggc gatggggccc aagccgcagt taagggggca caggctgagc tgatgaaggt gcaagcctta gagaaagtta aaggtgcaga tataaatgct gaagaggccc ccaaaatggt gcccaaggca gtggaggatg ggataaaggt ggctgacctg gaactagagg agggcctagc agaggagaag ctgaagactg tggaggaggc agcagctccc agagaagggc aaggaagctc tgctgtgggt tttgaagttc cacagcaaga tgtgatcctg ccagagtact aa. It is sometimes possible for the material contained within the vial of "CAMK4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.