Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CAMK1D cdna clone

CAMK1D cDNA Clone

Gene Names
CAMK1D; CKLiK; CaM-K1; CaMKID
Synonyms
CAMK1D; CAMK1D cDNA Clone; CAMK1D cdna clone
Ordering
For Research Use Only!
Sequence
atggcccgggagaacggcgagagcagctcctcctggaaaaagcaagctgaagacatcaagaagatcttcgagttcaaagagaccctcggaaccggggccttttccgaagtggttttagctgaagagaaggcaactggcaagctctttgctgtgaagtgtatccctaagaaggcgctgaagggcaaggaaagcagcatagagaatgagatagccgtcctgagaaagattaagcatgaaaatattgttgccctggaagacatttatgaaagcccaaatcacctgtacttggtcatgcagctggtgtccggtggagagctgtttgaccggatagtggagaaggggttttatacagagaaggatgccagcactctgatccgccaagtcttggacgccgtgtactatctccacagaatgggcatcgtccacagagacctcaagcccgaaaatctcttgtactacagtcaagatgaggagtccaaaataatgatcagtgactttggattgtcaaaaatggagggcaaaggagatgtgatgtccactgcctgtggaactccaggctatgtcgctcctgaagtcctcgcccagaaaccttacagcaaagccgttgactgctggtccatcggagtgattgcctacatcttgctctgcggctaccctcctttttatgatgaaaatgactccaagctctttgagcagatcctcaaggcggaatatgagtttgactctccctactgggatgacatctccgactctgcaaaagacttcattcggaacctgatggagaaggacccgaataaaagatacacgtgtgagcaggcagctcggcacccatggatcgctggtgacacagccctcaacaaaaacatccacgagtccgtcagcgcccagatccggaaaaactttgccaagagcaaatggagacaagcatttaatgccacggccgtcgtgagacatatgagaaaactacacctcggcagcagcctggacagttcaaatgcaagtgtttcgagcagcctcagtttggccagccaaaaagactgtctggcaccttccacgctctgtagtttcatttcttcttcgtcgggggtctcaggagttggagccgagcggagacccaggcccaccactgtgacggcagtgcactctggaagcaagtga
Sequence Length
1158
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,190 Da
NCBI Official Full Name
Homo sapiens calcium/calmodulin-dependent protein kinase ID, mRNA
NCBI Official Synonym Full Names
calcium/calmodulin dependent protein kinase ID
NCBI Official Symbol
CAMK1D
NCBI Official Synonym Symbols
CKLiK; CaM-K1; CaMKID
NCBI Protein Information
calcium/calmodulin-dependent protein kinase type 1D
UniProt Protein Name
Calcium/calmodulin-dependent protein kinase type 1D
UniProt Gene Name
CAMK1D
UniProt Synonym Gene Names
CAMKID; CaM kinase ID; CaM-KI delta; CaMKI delta; CaMKID; CKLiK
UniProt Entry Name
KCC1D_HUMAN

NCBI Description

This gene is a member of the calcium/calmodulin-dependent protein kinase 1 family, a subfamily of the serine/threonine kinases. The encoded protein is a component of the calcium-regulated calmodulin-dependent protein kinase cascade. It has been associated with multiple processes including regulation of granulocyte function, activation of CREB-dependent gene transcription, aldosterone synthesis, differentiation and activation of neutrophil cells, and apoptosis of erythroleukemia cells. Alternatively spliced transcript variants encoding different isoforms of this gene have been described. [provided by RefSeq, Jan 2015]

Uniprot Description

CAMK1D: a calcium/calmodulin-dependent S/T protein kinase of the CAMK group. Binding of calmodulin is thought to result in a conformational change and can lead to subsequent activation through phosphorylation by CAMKK1 and CAMKK2. Can be activated by CAMKK1 in a calcium-independent manner. Its Ca(2+)/CaM-dependent activity is enhanced 30-fold in vitro by phosphorylation at Thr180 by CaMKK1. Broadly expressed. Highly and mostly expressed in polymorphonuclear leukocytes (neutrophilic and eosinophilic granulocytes) while little or no expression is observed in monocytes and lymphocytes. May regulate calcium-mediated granulocyte function. May play a role in apoptosis of erythroleukemia cells. In vitro, phosphorylates transcription factor CREM isoform Beta and probably CREB1. Expression increases upon treatment of EC cells with DMSO and retinoic acid. Two isoforms of the human protein are produced by alternative splicing.

Protein type: Kinase, protein; EC 2.7.11.17; Protein kinase, CAMK; Protein kinase, Ser/Thr (non-receptor); CAMK group; CAMK1 family

Chromosomal Location of Human Ortholog: 10p13

Cellular Component: cytoplasm; nucleus

Biological Process: activation of CREB transcription factor; positive regulation of phagocytosis; regulation of dendrite development

Research Articles on CAMK1D

Similar Products

Product Notes

The CAMK1D camk1d (Catalog #AAA1272082) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccggg agaacggcga gagcagctcc tcctggaaaa agcaagctga agacatcaag aagatcttcg agttcaaaga gaccctcgga accggggcct tttccgaagt ggttttagct gaagagaagg caactggcaa gctctttgct gtgaagtgta tccctaagaa ggcgctgaag ggcaaggaaa gcagcataga gaatgagata gccgtcctga gaaagattaa gcatgaaaat attgttgccc tggaagacat ttatgaaagc ccaaatcacc tgtacttggt catgcagctg gtgtccggtg gagagctgtt tgaccggata gtggagaagg ggttttatac agagaaggat gccagcactc tgatccgcca agtcttggac gccgtgtact atctccacag aatgggcatc gtccacagag acctcaagcc cgaaaatctc ttgtactaca gtcaagatga ggagtccaaa ataatgatca gtgactttgg attgtcaaaa atggagggca aaggagatgt gatgtccact gcctgtggaa ctccaggcta tgtcgctcct gaagtcctcg cccagaaacc ttacagcaaa gccgttgact gctggtccat cggagtgatt gcctacatct tgctctgcgg ctaccctcct ttttatgatg aaaatgactc caagctcttt gagcagatcc tcaaggcgga atatgagttt gactctccct actgggatga catctccgac tctgcaaaag acttcattcg gaacctgatg gagaaggacc cgaataaaag atacacgtgt gagcaggcag ctcggcaccc atggatcgct ggtgacacag ccctcaacaa aaacatccac gagtccgtca gcgcccagat ccggaaaaac tttgccaaga gcaaatggag acaagcattt aatgccacgg ccgtcgtgag acatatgaga aaactacacc tcggcagcag cctggacagt tcaaatgcaa gtgtttcgag cagcctcagt ttggccagcc aaaaagactg tctggcacct tccacgctct gtagtttcat ttcttcttcg tcgggggtct caggagttgg agccgagcgg agacccaggc ccaccactgt gacggcagtg cactctggaa gcaagtga. It is sometimes possible for the material contained within the vial of "CAMK1D, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.