Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CALU cdna clone

CALU cDNA Clone

Synonyms
CALU; CALU cDNA Clone; CALU cdna clone
Ordering
For Research Use Only!
Sequence
atggacctgcgacagtttcttatgtgcctgtccctgtgcacagcctttgccttgagcaaacccacagaaaagaaggaccgtgtacatcatgagcctcagctcagtgacaaggttcacaatgatgctcagagttttgattatgaccatgatgccttcttgggtgctgaagaagcaaagacctttgatcagctgacaccagaagagagcaaggaaaggcttggaaagattgtaagtaaaatagatggcgacaaggacgggtttgtcactgtggatgagctcaaagactggattaaatttgcacaaaagcgctggatttacgaggatgtagagcgacagtggaaggggcatgacctcaatgaggacggcctcgtttcctgggaggagtataaaaatgccacctacggctacgttttagatgatccagatcctgatgatggatttaactataaacagatgatggttagagatgagcggaggtttaaaatggcagacaaggatggagacctcattgccaccaaggaggagttcacagctttcctgcaccctgaggagtatgactacatgaaagatatagtagtacaggaaacaatggaagatatagataagaatgctgatggtttcattgatctagaagagtatattggtgacatgtacagccatgatgggaatactgatgagccagaatgggtaaagacagagcgagagcagtttgttgagtttcgggataagaaccgtgatgggaagatggacaaggaagagaccaaagactggatccttccctcagactatgatcatgcagaggcagaagccaggcacctggtctatgaatcagaccaaaacaaggatggcaagcttaccaaggaggagatcgttgacaagtatgacttatttgttggcagccaggccacagattttggggaggccttagtacggcatgatgagttctga
Sequence Length
948
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
813
Molecular Weight
19,455 Da
NCBI Official Full Name
Homo sapiens calumenin, mRNA
NCBI Official Synonym Full Names
calumenin
NCBI Official Symbol
CALU
NCBI Protein Information
calumenin
UniProt Protein Name
Calumenin
Protein Family
UniProt Gene Name
CALU
UniProt Entry Name
CALU_HUMAN

NCBI Description

The product of this gene is a calcium-binding protein localized in the endoplasmic reticulum (ER) and it is involved in such ER functions as protein folding and sorting. This protein belongs to a family of multiple EF-hand proteins (CERC) that include reticulocalbin, ERC-55, and Cab45 and the product of this gene. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]

Uniprot Description

CALU: Involved in regulation of vitamin K-dependent carboxylation of multiple N-terminal glutamate residues. Seems to inhibit gamma-carboxylase GGCX. Binds 7 calcium ions with a low affinity. Belongs to the CREC family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted; Secreted, signal peptide; Calcium-binding

Chromosomal Location of Human Ortholog: 7q32.1

Cellular Component: endoplasmic reticulum; membrane

Molecular Function: calcium ion binding; protein binding

Research Articles on CALU

Similar Products

Product Notes

The CALU calu (Catalog #AAA1276085) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacctgc gacagtttct tatgtgcctg tccctgtgca cagcctttgc cttgagcaaa cccacagaaa agaaggaccg tgtacatcat gagcctcagc tcagtgacaa ggttcacaat gatgctcaga gttttgatta tgaccatgat gccttcttgg gtgctgaaga agcaaagacc tttgatcagc tgacaccaga agagagcaag gaaaggcttg gaaagattgt aagtaaaata gatggcgaca aggacgggtt tgtcactgtg gatgagctca aagactggat taaatttgca caaaagcgct ggatttacga ggatgtagag cgacagtgga aggggcatga cctcaatgag gacggcctcg tttcctggga ggagtataaa aatgccacct acggctacgt tttagatgat ccagatcctg atgatggatt taactataaa cagatgatgg ttagagatga gcggaggttt aaaatggcag acaaggatgg agacctcatt gccaccaagg aggagttcac agctttcctg caccctgagg agtatgacta catgaaagat atagtagtac aggaaacaat ggaagatata gataagaatg ctgatggttt cattgatcta gaagagtata ttggtgacat gtacagccat gatgggaata ctgatgagcc agaatgggta aagacagagc gagagcagtt tgttgagttt cgggataaga accgtgatgg gaagatggac aaggaagaga ccaaagactg gatccttccc tcagactatg atcatgcaga ggcagaagcc aggcacctgg tctatgaatc agaccaaaac aaggatggca agcttaccaa ggaggagatc gttgacaagt atgacttatt tgttggcagc caggccacag attttgggga ggccttagta cggcatgatg agttctga. It is sometimes possible for the material contained within the vial of "CALU, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.