Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CALM1 cdna clone

CALM1 cDNA Clone

Gene Names
CALM1; caM; CAMI; PHKD; CPVT4; DD132; LQT14; CALML2
Synonyms
CALM1; CALM1 cDNA Clone; CALM1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaggtcactgggtcagaacccaacagaagctgaattgcaggatatgatcaatgaagtggatgctgatggtaatggcaccattgacttccccgaatttttgactatgatggctagaaaaatgaaagatacagatagtgaagaagaaatccgtgaggcattccgagtctttgacaaggatggcaatggttatatcagtgcagcagaactacgtcacgtcatgacaaacttaggagaaaaactaacagatgaagaagtagatgaaatgatcagagaagcagatattgatggagacggacaagtcaactatgaagaattcgtacagatgatgactgcaaaatga
Sequence Length
342
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
801
Molecular Weight
16,838 Da
NCBI Official Full Name
Homo sapiens calmodulin 1 (phosphorylase kinase, delta), mRNA
NCBI Official Synonym Full Names
calmodulin 1
NCBI Official Symbol
CALM1
NCBI Official Synonym Symbols
caM; CAMI; PHKD; CPVT4; DD132; LQT14; CALML2
NCBI Protein Information
calmodulin
UniProt Protein Name
Calmodulin
Protein Family
UniProt Gene Name
CALM1
UniProt Synonym Gene Names
CALM; CAM; CAM1; CaM
UniProt Entry Name
CALM_HUMAN

NCBI Description

This gene encodes a member of the EF-hand calcium-binding protein family. It is one of three genes which encode an identical calcium binding protein which is one of the four subunits of phosphorylase kinase. Two pseudogenes have been identified on chromosome 7 and X. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]

Uniprot Description

Calmodulin: a calcium-binding small regulatory protein that mediates the control of a large number of enzymes by Ca(2+). Among the enzymes to be stimulated by the calmodulin-Ca(2+) complex are a number of protein kinases and phosphatases. Has four functional calcium-binding domains. Phosphorylation and ubiquitination result in a decreased activity.

Protein type: Calcium-binding

Chromosomal Location of Human Ortholog: 14q32.11

Cellular Component: centrosome; cytoplasm; cytosol; extracellular region; nucleoplasm; nucleus; plasma membrane; sarcomere; spindle microtubule; spindle pole; vesicle

Molecular Function: calcium ion binding; inositol trisphosphate 3-kinase activity; ligand-gated ion channel activity; N-terminal myristoylation domain binding; phospholipase binding; protein binding; protein domain specific binding; protein kinase binding; protein serine/threonine kinase activator activity; Ras guanyl-nucleotide exchange factor activity; thioesterase binding; titin binding

Biological Process: detection of calcium ion; G-protein coupled receptor protein signaling pathway; glycogen catabolic process; inositol phosphate metabolic process; MAPKKK cascade; muscle contraction; platelet degranulation; positive regulation of cyclic nucleotide metabolic process; positive regulation of cyclic-nucleotide phosphodiesterase activity; positive regulation of phosphoprotein phosphatase activity; positive regulation of protein amino acid autophosphorylation; positive regulation of protein amino acid dephosphorylation; regulation of cytokinesis; regulation of heart rate; regulation of nitric-oxide synthase activity; regulation of rhodopsin mediated signaling; response to calcium ion; substantia nigra development; Wnt receptor signaling pathway, calcium modulating pathway

Disease: Long Qt Syndrome 14; Ventricular Tachycardia, Catecholaminergic Polymorphic, 4

Research Articles on CALM1

Similar Products

Product Notes

The CALM1 calm1 (Catalog #AAA1274289) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaggtcac tgggtcagaa cccaacagaa gctgaattgc aggatatgat caatgaagtg gatgctgatg gtaatggcac cattgacttc cccgaatttt tgactatgat ggctagaaaa atgaaagata cagatagtga agaagaaatc cgtgaggcat tccgagtctt tgacaaggat ggcaatggtt atatcagtgc agcagaacta cgtcacgtca tgacaaactt aggagaaaaa ctaacagatg aagaagtaga tgaaatgatc agagaagcag atattgatgg agacggacaa gtcaactatg aagaattcgt acagatgatg actgcaaaat ga. It is sometimes possible for the material contained within the vial of "CALM1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.