Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CACNG7 cdna clone

CACNG7 cDNA Clone

Synonyms
CACNG7; CACNG7 cDNA Clone; CACNG7 cdna clone
Ordering
For Research Use Only!
Sequence
atgagtcactgcagcagccgcgccctgaccctgctgagcagcgtgtttggtgcgtgtggcctgctcctggtaggcatcgcggtcagcactgactactggctgtacatggaagaaggcacagtgctaccgcagaaccagaccaccgaggtcaagatggccctgcacgccggcctctggcgagtctgcttctttgcaggtcgggagaaaggtcgctgtgtggcctcagaatattttcttgaaccggagatcaatttggtgacggaaaacacggagaatattctgaagacagtgcgcacggccacccccttccccatggtcagcctcttcctcgtgttcacggccttcgtcatcagcaacatcggccacatccgcccgcagaggaccattctggcttttgtctctggcatcttcttcatactatcgggcctctccttggtggtgggcttggttctttacatctccagcatcaacgacgaggtcatgaacaggcccagcagctctgagcagtattttcattatcgctacgggtggtcttttgccttcgccgcttcctccttcctactcaaagagggggccggcgtgatgtccgtgtacctgttcaccaagcgctacgcggaggaggagatgtaccgtccacacccggccttctaccgcccgcgtctcagcgactgctccgactactcgggccagttcctgcagcccgaggcgtggcgccgcggccggagcccctccgacatctccagcgacgtgtccatccaaatgacgcagaactaccctcccgccatcaagtacccggaccacctgcacatctccacctcgccctgctga
Sequence Length
828
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
31,003 Da
NCBI Official Full Name
Homo sapiens calcium channel, voltage-dependent, gamma subunit 7, mRNA
NCBI Official Synonym Full Names
calcium voltage-gated channel auxiliary subunit gamma 7
NCBI Official Symbol
CACNG7
NCBI Protein Information
voltage-dependent calcium channel gamma-7 subunit
UniProt Protein Name
Voltage-dependent calcium channel gamma-7 subunit
UniProt Gene Name
CACNG7
UniProt Synonym Gene Names
TARP gamma-7
UniProt Entry Name
CCG7_HUMAN

NCBI Description

The protein encoded by this gene is a type II transmembrane AMPA receptor regulatory protein (TARP). TARPs regulate both trafficking and channel gating of the AMPA receptors. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family and is located in a cluster with two family members, a type I TARP and a calcium channel gamma subunit. [provided by RefSeq, Dec 2010]

Uniprot Description

CACNG7: Regulates the trafficking and gating properties of AMPA- selective glutamate receptors (AMPARs). Promotes their targeting to the cell membrane and synapses and modulates their gating properties by slowing their rates of activation, deactivation and desensitization and by mediating their resensitization. Displays subunit-specific AMPA receptor regulation. Shows specificity only for GRIA1 and GRIA2. Thought to stabilize the calcium channel in an inactivated (closed) state. Belongs to the PMP-22/EMP/MP20 family. CACNG subfamily.

Protein type: Membrane protein, multi-pass; Channel, calcium; Membrane protein, integral

Chromosomal Location of Human Ortholog: 19q13.4

Cellular Component: plasma membrane

Molecular Function: channel regulator activity; voltage-gated calcium channel activity

Biological Process: transmission of nerve impulse

Similar Products

Product Notes

The CACNG7 cacng7 (Catalog #AAA1276424) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtcact gcagcagccg cgccctgacc ctgctgagca gcgtgtttgg tgcgtgtggc ctgctcctgg taggcatcgc ggtcagcact gactactggc tgtacatgga agaaggcaca gtgctaccgc agaaccagac caccgaggtc aagatggccc tgcacgccgg cctctggcga gtctgcttct ttgcaggtcg ggagaaaggt cgctgtgtgg cctcagaata ttttcttgaa ccggagatca atttggtgac ggaaaacacg gagaatattc tgaagacagt gcgcacggcc acccccttcc ccatggtcag cctcttcctc gtgttcacgg ccttcgtcat cagcaacatc ggccacatcc gcccgcagag gaccattctg gcttttgtct ctggcatctt cttcatacta tcgggcctct ccttggtggt gggcttggtt ctttacatct ccagcatcaa cgacgaggtc atgaacaggc ccagcagctc tgagcagtat tttcattatc gctacgggtg gtcttttgcc ttcgccgctt cctccttcct actcaaagag ggggccggcg tgatgtccgt gtacctgttc accaagcgct acgcggagga ggagatgtac cgtccacacc cggccttcta ccgcccgcgt ctcagcgact gctccgacta ctcgggccag ttcctgcagc ccgaggcgtg gcgccgcggc cggagcccct ccgacatctc cagcgacgtg tccatccaaa tgacgcagaa ctaccctccc gccatcaagt acccggacca cctgcacatc tccacctcgc cctgctga. It is sometimes possible for the material contained within the vial of "CACNG7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.