Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CACNG4 cdna clone

CACNG4 cDNA Clone

Synonyms
CACNG4; CACNG4 cDNA Clone; CACNG4 cdna clone
Ordering
For Research Use Only!
Sequence
atggtgcgatgcgaccgcgggctgcagatgctgctgaccacggccggagccttcgccgccttctcgctcatggccatcgccatcggcaccgactactggctgtactccagcgcgcacatctgcaacggcaccaacctgaccatggacgacgggcccccgccccgccgcgcccgcggcgacctcacccactctggtctgtggcgggtgtgctgcatcgaagggatctataaagggcactgcttccggatcaatcacttcccagaggacaatgactacgaccacgacagctcggagtacctcctccgcatcgtgcgagcctccagcgtcttccccatcctcagcaccatcctgctcctgctgggtggcctgtgcatcggtgctggcaggatctacagccgcaagaacaacatcgtcctcagtgccggcatcctcttcgtggctgcaggcctcagtaacatcatcggtatcatcgtctacatttccagcaacacaggtgacccgagtgacaagcgggacgaagacaaaaagaaccattacaactacggctggtctttttactttggagctctgtctttcattgtggctgagaccgtgggcgtcctggctgtaaacatttacattgagaaaaataaagagttgaggtttaagaccaaacgggaattccttaaggcgtcttcctcttctccttatgccaggatgccgagctacaggtaccggcgacggcgctcgaggtccagctcaaggtccactgaggcctcgccctccagggacgtgtcgcccatgggcctgaagatcacaggggccatccccatgggggagctgtccatgtacacgctgtccagggagcccctcaaggtgaccaccgcagccagctacagccccgaccaggaggccagcttcctgcaggtgcatgactttttccagcaggacctgaaggaaggtttccacgtcagcatgctgaaccgacggacgacccctgtgtga
Sequence Length
984
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,579 Da
NCBI Official Full Name
Homo sapiens calcium channel, voltage-dependent, gamma subunit 4, mRNA
NCBI Official Synonym Full Names
calcium voltage-gated channel auxiliary subunit gamma 4
NCBI Official Symbol
CACNG4
NCBI Protein Information
voltage-dependent calcium channel gamma-4 subunit
UniProt Protein Name
Voltage-dependent calcium channel gamma-4 subunit
UniProt Gene Name
CACNG4
UniProt Synonym Gene Names
TARP gamma-4
UniProt Entry Name
CCG4_HUMAN

NCBI Description

The protein encoded by this gene is a type I transmembrane AMPA receptor regulatory protein (TARP). TARPs regulate both trafficking and channel gating of the AMPA receptors. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family and is located in a cluster with two family members, a type II TARP and a calcium channel gamma subunit. [provided by RefSeq, Dec 2010]

Uniprot Description

CACNG4: Regulates the trafficking and gating properties of AMPA- selective glutamate receptors (AMPARs). Promotes their targeting to the cell membrane and synapses and modulates their gating properties by slowing their rates of activation, deactivation and desensitization and by mediating their resensitization. Does not show subunit-specific AMPA receptor regulation and regulates all AMPAR subunits. Thought to stabilize the calcium channel in an inactivated (closed) state. Belongs to the PMP-22/EMP/MP20 family. CACNG subfamily.

Protein type: Channel, calcium; Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 17q24

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: calcium channel activity; channel regulator activity

Biological Process: membrane depolarization; transmission of nerve impulse; transport

Research Articles on CACNG4

Similar Products

Product Notes

The CACNG4 cacng4 (Catalog #AAA1275226) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgcgat gcgaccgcgg gctgcagatg ctgctgacca cggccggagc cttcgccgcc ttctcgctca tggccatcgc catcggcacc gactactggc tgtactccag cgcgcacatc tgcaacggca ccaacctgac catggacgac gggcccccgc cccgccgcgc ccgcggcgac ctcacccact ctggtctgtg gcgggtgtgc tgcatcgaag ggatctataa agggcactgc ttccggatca atcacttccc agaggacaat gactacgacc acgacagctc ggagtacctc ctccgcatcg tgcgagcctc cagcgtcttc cccatcctca gcaccatcct gctcctgctg ggtggcctgt gcatcggtgc tggcaggatc tacagccgca agaacaacat cgtcctcagt gccggcatcc tcttcgtggc tgcaggcctc agtaacatca tcggtatcat cgtctacatt tccagcaaca caggtgaccc gagtgacaag cgggacgaag acaaaaagaa ccattacaac tacggctggt ctttttactt tggagctctg tctttcattg tggctgagac cgtgggcgtc ctggctgtaa acatttacat tgagaaaaat aaagagttga ggtttaagac caaacgggaa ttccttaagg cgtcttcctc ttctccttat gccaggatgc cgagctacag gtaccggcga cggcgctcga ggtccagctc aaggtccact gaggcctcgc cctccaggga cgtgtcgccc atgggcctga agatcacagg ggccatcccc atgggggagc tgtccatgta cacgctgtcc agggagcccc tcaaggtgac caccgcagcc agctacagcc ccgaccagga ggccagcttc ctgcaggtgc atgacttttt ccagcaggac ctgaaggaag gtttccacgt cagcatgctg aaccgacgga cgacccctgt gtga. It is sometimes possible for the material contained within the vial of "CACNG4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.