C9orf106 cdna clone
C9orf106 cDNA Clone
Gene Names
C9orf106; bA65J3.5
Synonyms
C9orf106; C9orf106 cDNA Clone; C9orf106 cdna clone
Sequence
atggcgtatgtggccttgagcgataaacctcacctgtcgggggaggtgggcgaggaagcctgcagctcctggaacccaccacttttctctcccaggcccttgcccaggctgtggcctctgcctggaaccccttttcttcccatccgagcccttcccttcagtgcctcttcctctgggaagtcctctctggtgcccagcccgtcctcttctgcccactctgggtttcgcaccccatgcttaggccctgattgcctgctttgcacacagggctgtgagctccatgagggcaggaaccacatggctgttcacagctgtgttgccagggcctggcctggagaccctcaggaagtgagacatctgaatcctctgctctgtgaccctggcagccaggtagagccatcttggccatggcacccaggcttggagcaagcagcagcctcatgggtggggaaccacgtttccccagcacatcggcaggccctaaggggacattcgcttggctctgccctcagagcactgatgcccgggagacactgccctttgtgtgtcccatgtaagagaggatgcaaccttagagggggcaggggtaaacatggtcccaggccctgttgtcccctcctaagaaagttcccagttctgcctgtccatccctggccttttccctgtgctgtctgggacagtgggtggagctgccgctga
Sequence Length
699
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
25,113 Da
NCBI Official Full Name
Homo sapiens chromosome 9 open reading frame 106, mRNA
NCBI Official Synonym Full Names
chromosome 9 open reading frame 106
NCBI Official Symbol
C9orf106
NCBI Official Synonym Symbols
bA65J3.5
NCBI Protein Information
putative uncharacterized protein C9orf106
UniProt Protein Name
Putative uncharacterized protein C9orf106
Protein Family
UniProt Gene Name
C9orf106
UniProt Entry Name
CI106_HUMAN
Uniprot Description
C9orf106:
Chromosomal Location of Human Ortholog: 9q34.11
Similar Products
Product Notes
The C9orf106 c9orf106 (Catalog #AAA1267159) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgtatg tggccttgag cgataaacct cacctgtcgg gggaggtggg cgaggaagcc tgcagctcct ggaacccacc acttttctct cccaggccct tgcccaggct gtggcctctg cctggaaccc cttttcttcc catccgagcc cttcccttca gtgcctcttc ctctgggaag tcctctctgg tgcccagccc gtcctcttct gcccactctg ggtttcgcac cccatgctta ggccctgatt gcctgctttg cacacagggc tgtgagctcc atgagggcag gaaccacatg gctgttcaca gctgtgttgc cagggcctgg cctggagacc ctcaggaagt gagacatctg aatcctctgc tctgtgaccc tggcagccag gtagagccat cttggccatg gcacccaggc ttggagcaag cagcagcctc atgggtgggg aaccacgttt ccccagcaca tcggcaggcc ctaaggggac attcgcttgg ctctgccctc agagcactga tgcccgggag acactgccct ttgtgtgtcc catgtaagag aggatgcaac cttagagggg gcaggggtaa acatggtccc aggccctgtt gtcccctcct aagaaagttc ccagttctgc ctgtccatcc ctggcctttt ccctgtgctg tctgggacag tgggtggagc tgccgctga. It is sometimes possible for the material contained within the vial of "C9orf106, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
