Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

C8B cdna clone

C8B cDNA Clone

Gene Names
C8B; C82
Synonyms
C8B; C8B cDNA Clone; C8B cdna clone
Ordering
For Research Use Only!
Sequence
atgaagaattccaggacatgggcttggagggcgccggtggagctatttcttctctgtgctgccctgggctgtctcagtttgcctggctccagaggtgaaaggccacattcctttgggtcaaatgcagtcaacaagagctttgctaagagcagacagatgcggagtgtggatgttaccctgatgcccattgattgtgagctgtctagttggtcctcttggaccacatgtgacccctgtcagaagaaaaggtacaggtatgcctacttgctccagccctctcagttccatggggaaccgtgcaacttctctgacaaggaagtcgaagactgtgttaccaacagaccatgcagaagtcaagtgcgatgtgaaggctttgtgtgtgcacagacaggaaggtgtgtaaaccgcagacttctttgcaatggggacaatgactgtggagaccagtcagatgaagcaaactgtagaaggatttataaaaaatgtcagcatgaaatggaccaatactggggaattggcagtctggccagtgggataaatttgttcacaaacagttttgagggcccagttcttgatcacaggtattatgcaggtggatgctccccgcattacatcctgaacacgaggtttaggaagccctacaatgtggaaagctacacgccacagacccaaggcaaatacgaattcatattaaaagagtatgaatcatactcagattttgaacgcaatgtcacagagaaaatggcaagcaagtctggtttcagttttggttttaaaatacctggaatatttgaacttggcatcagtagtcaaagtgatcgaggcaaacactatattaggagaaccaaacgattctctcatactaaaagcgtatttctgcatgcacgctctgaccttgaagtagcacattacaagctgaaacccagaagcctcatgctccattacgagttccttcagagagttaagcggctgcccctggagtacagctacggggaatacagagatctcttccgtgattttgggacccactacatcacagaggctgtgcttgggggcatttatgaatacaccctcgttatgaacaaagaggccatggagagaggagattatactcttaacaacgtccatgcctgtgccaaaaatgattttaaaattggtggtgccattgaagaggtctacgtcagtctgggtgtgtctgtaggcaaatgcagaggtattctgaatgaaataaaagacagaaacaagagggacaccatggtggaggacttggtggtcctggtacgaggaggggcaagtgagcacatcaccaccctggcataccaggagctgccgacggcggacctgatgcaggagtggggagacgctgtgcagtacaacccagccatcatcaaagttaaggtggagcctctgtatgaactagtgacagccacagattttgcctattccagcacagtgaggcagaacatgaagcaggcactggaggagttccagaaggaagttagttcctgccactgtgctccctgccaaggaaatggagtccctgtcctgaaaggatcacgctgtgactgcatctgtcctgttggatcccaaggcctagcctgtgaggtctcctatcggaagaatacccccattgatgggaagtggaattgctggtcaaattggtcttcatgctctggaagacgtaagacaagacaaaggcagtgtaacaatccacctcctcaaaatgggggtagcccctgttcaggccctgcttcagaaacacttgactgctcctag
Sequence Length
1776
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
732
Molecular Weight
67,047 Da
NCBI Official Full Name
Homo sapiens complement component 8, beta polypeptide, mRNA
NCBI Official Synonym Full Names
complement C8 beta chain
NCBI Official Symbol
C8B
NCBI Official Synonym Symbols
C82
NCBI Protein Information
complement component C8 beta chain
UniProt Protein Name
Complement component C8 beta chain
Protein Family
UniProt Gene Name
C8B
UniProt Entry Name
CO8B_HUMAN

NCBI Description

This gene encodes one of the three subunits of the complement component 8 (C8) protein. C8 is composed of equimolar amounts of alpha, beta and gamma subunits, which are encoded by three separate genes. C8 is one component of the membrane attack complex, which mediates cell lysis, and it initiates membrane penetration of the complex. This protein mediates the interaction of C8 with the C5b-7 membrane attack complex precursor. In humans deficiency of this protein is associated with increased risk of meningococcal infections. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]

Uniprot Description

C8B: Constituent of the membrane attack complex (MAC) that plays a key role in the innate and adaptive immune response by forming pores in the plasma membrane of target cells. Defects in C8B are a cause of complement component 8 deficiency type 2 (C8D2). A rare defect of the complement classical pathway associated with susceptibility to severe recurrent infections, predominantly by Neisseria gonorrhoeae or Neisseria meningitidis. Belongs to the complement C6/C7/C8/C9 family.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 1p32.2

Cellular Component: extracellular region; membrane

Biological Process: complement activation; immune response; regulation of complement activation

Disease: Complement Component 8 Deficiency, Type Ii

Research Articles on C8B

Similar Products

Product Notes

The C8B c8b (Catalog #AAA1278138) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagaatt ccaggacatg ggcttggagg gcgccggtgg agctatttct tctctgtgct gccctgggct gtctcagttt gcctggctcc agaggtgaaa ggccacattc ctttgggtca aatgcagtca acaagagctt tgctaagagc agacagatgc ggagtgtgga tgttaccctg atgcccattg attgtgagct gtctagttgg tcctcttgga ccacatgtga cccctgtcag aagaaaaggt acaggtatgc ctacttgctc cagccctctc agttccatgg ggaaccgtgc aacttctctg acaaggaagt cgaagactgt gttaccaaca gaccatgcag aagtcaagtg cgatgtgaag gctttgtgtg tgcacagaca ggaaggtgtg taaaccgcag acttctttgc aatggggaca atgactgtgg agaccagtca gatgaagcaa actgtagaag gatttataaa aaatgtcagc atgaaatgga ccaatactgg ggaattggca gtctggccag tgggataaat ttgttcacaa acagttttga gggcccagtt cttgatcaca ggtattatgc aggtggatgc tccccgcatt acatcctgaa cacgaggttt aggaagccct acaatgtgga aagctacacg ccacagaccc aaggcaaata cgaattcata ttaaaagagt atgaatcata ctcagatttt gaacgcaatg tcacagagaa aatggcaagc aagtctggtt tcagttttgg ttttaaaata cctggaatat ttgaacttgg catcagtagt caaagtgatc gaggcaaaca ctatattagg agaaccaaac gattctctca tactaaaagc gtatttctgc atgcacgctc tgaccttgaa gtagcacatt acaagctgaa acccagaagc ctcatgctcc attacgagtt ccttcagaga gttaagcggc tgcccctgga gtacagctac ggggaataca gagatctctt ccgtgatttt gggacccact acatcacaga ggctgtgctt gggggcattt atgaatacac cctcgttatg aacaaagagg ccatggagag aggagattat actcttaaca acgtccatgc ctgtgccaaa aatgatttta aaattggtgg tgccattgaa gaggtctacg tcagtctggg tgtgtctgta ggcaaatgca gaggtattct gaatgaaata aaagacagaa acaagaggga caccatggtg gaggacttgg tggtcctggt acgaggaggg gcaagtgagc acatcaccac cctggcatac caggagctgc cgacggcgga cctgatgcag gagtggggag acgctgtgca gtacaaccca gccatcatca aagttaaggt ggagcctctg tatgaactag tgacagccac agattttgcc tattccagca cagtgaggca gaacatgaag caggcactgg aggagttcca gaaggaagtt agttcctgcc actgtgctcc ctgccaagga aatggagtcc ctgtcctgaa aggatcacgc tgtgactgca tctgtcctgt tggatcccaa ggcctagcct gtgaggtctc ctatcggaag aataccccca ttgatgggaa gtggaattgc tggtcaaatt ggtcttcatg ctctggaaga cgtaagacaa gacaaaggca gtgtaacaat ccacctcctc aaaatggggg tagcccctgt tcaggccctg cttcagaaac acttgactgc tcctag. It is sometimes possible for the material contained within the vial of "C8B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.