C5orf25 cdna clone
C5orf25 cDNA Clone
Gene Names
SIMC1; OOMA1; PLEIAD; C5orf25
Synonyms
C5orf25; C5orf25 cDNA Clone; C5orf25 cdna clone
Sequence
atgcctagatcctttgaacaagtaataatacttaaaaaatggtttctgaaaccttataagggacaaactctgcctgggcgagtccttttcctgcgttatgtcgttcagaccctagaagatgactttcagcagaccctgaggaggcaacggcagcacctgcagcaatccattgcaaacatggtgctttcctgtgacaagcagccccacaatgtcagggatgttatcaagtggctggtcaaagcagtaactgaagatggattgactcagcccccaaatggaaatcaaacgtcttcaggaacaggaatcttgaaagccagcagtagccacccttcttcccagcccaacctgacaaagaacaccaatcagctgattgtgtgccagcttcagaggatgctctccatagccgtagaggtggacaggacccccacctgcagctccaataaaattgccgagatgatgtttgggtttgtgctggacattcctgagaggagccagagagaaatgttctttactaccatggaaagccaccttctgcgctgcaaagtgttagaaatcatattcctccacagctgtgagacacccacccgcctgcctctgtctctggcccaggccctctactttctgaataattctacgtcactgctcaagtgtcagtcagataaaagccagtggcagacttgggacgaattggttgagcatctgcagtttctgctgtccagttatcaacatgttttaagagaacacttaaggagttccgtgatcgaccgaaaggacttaataatcaaaaggattaagcccaaaccccagcaaggagatgacatcacagtggtagacgtagagaagcagattgaggccttccgcagccgcctgatccagatgctgggggagcctcttgtcccccaactccaagacaaagtgcacttgttgaagctcctgctcttctatgctgcggacttgaaccctgatgcagagccctttcaaaagggctggagcggctcctga
Sequence Length
1002
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
38,363 Da
NCBI Official Full Name
Homo sapiens chromosome 5 open reading frame 25, mRNA
NCBI Official Synonym Full Names
SUMO interacting motifs containing 1
NCBI Official Symbol
SIMC1
NCBI Official Synonym Symbols
OOMA1; PLEIAD; C5orf25
NCBI Protein Information
SUMO-interacting motif-containing protein 1
UniProt Protein Name
SUMO-interacting motif-containing protein 1
UniProt Gene Name
SIMC1
UniProt Synonym Gene Names
C5orf25
UniProt Entry Name
SIMC1_HUMAN
Uniprot Description
SIMC1: 4 isoforms of the human protein are produced by alternative splicing.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 5q35.2
Molecular Function: SUMO polymer binding
Research Articles on C5orf25
Similar Products
Product Notes
The C5orf25 simc1 (Catalog #AAA1277312) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctagat cctttgaaca agtaataata cttaaaaaat ggtttctgaa accttataag ggacaaactc tgcctgggcg agtccttttc ctgcgttatg tcgttcagac cctagaagat gactttcagc agaccctgag gaggcaacgg cagcacctgc agcaatccat tgcaaacatg gtgctttcct gtgacaagca gccccacaat gtcagggatg ttatcaagtg gctggtcaaa gcagtaactg aagatggatt gactcagccc ccaaatggaa atcaaacgtc ttcaggaaca ggaatcttga aagccagcag tagccaccct tcttcccagc ccaacctgac aaagaacacc aatcagctga ttgtgtgcca gcttcagagg atgctctcca tagccgtaga ggtggacagg acccccacct gcagctccaa taaaattgcc gagatgatgt ttgggtttgt gctggacatt cctgagagga gccagagaga aatgttcttt actaccatgg aaagccacct tctgcgctgc aaagtgttag aaatcatatt cctccacagc tgtgagacac ccacccgcct gcctctgtct ctggcccagg ccctctactt tctgaataat tctacgtcac tgctcaagtg tcagtcagat aaaagccagt ggcagacttg ggacgaattg gttgagcatc tgcagtttct gctgtccagt tatcaacatg ttttaagaga acacttaagg agttccgtga tcgaccgaaa ggacttaata atcaaaagga ttaagcccaa accccagcaa ggagatgaca tcacagtggt agacgtagag aagcagattg aggccttccg cagccgcctg atccagatgc tgggggagcc tcttgtcccc caactccaag acaaagtgca cttgttgaag ctcctgctct tctatgctgc ggacttgaac cctgatgcag agccctttca aaagggctgg agcggctcct ga. It is sometimes possible for the material contained within the vial of "C5orf25, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
