Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

C4orf49 cdna clone

C4orf49 cDNA Clone

Gene Names
MGARP; OSAP; HUMMR; CESP-1; C4orf49
Synonyms
C4orf49; C4orf49 cDNA Clone; C4orf49 cdna clone
Ordering
For Research Use Only!
Sequence
ATGTATCTCCGCAGGGCGGTCTCCAAGACTCTGGCGCTGCCGCTGAGGGCGCCCCCCAACCCCGCGCCGCTCGGAAAGGACGCATCTCTGCGCCGGATGTCATCTAACAGATTCCCTGGATCATCTGGATCAAATATGATTTATTATCTGGTTGTAGGCGTCACAGTCAGTGCTGGTGGATATTATGCTTACAAGACAGTCACATCAGACCAAGCCAAACACACAGAACATAAAACAAATTTGAAAGAAAAAACAAAAGCAGAGATACATCCATTTCAAGGTGAAAAGGAGAATGTTGCGGAAACTGAGAAAGCAAGTTCAGAAGCCCCAGAAGAACTTATAGTGGAAGCTGAGGTGGTAGATGCTGAAGAAAGTCCCAGTGCTACAGTTGTGGTCATAAAAGAGGCATCTGCCTGTCCAGGTCACGTGGAGGCTGCTCCGGAGACCACAGCAGTCAGTGCTGAAACCGGGCCAGAGGTCACAGATGCAGCGGCGAGGGAAACCACGGAAGTAAACCCTGAAACAACCCCAGAGGTTACAAATGCTGCCCTGGATGAAGCTGTCACCATCGATAATGATAAAGATACAACAAAGAACGAAACCTCTGATGAATATGCTGAACTAGAAGAAGAAAATTCTCCAGCTGAGTCAGAGTCCTCTGCTGGAGATGATTTACAGGAGGAAGCCAGTGTTGGCTCTGAGGCTGCTTCGGCTCAAGGCTAA
Sequence Length
723
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,390 Da
NCBI Official Full Name
Homo sapiens chromosome 4 open reading frame 49, mRNA
NCBI Official Synonym Full Names
mitochondria localized glutamic acid rich protein
NCBI Official Symbol
MGARP
NCBI Official Synonym Symbols
OSAP; HUMMR; CESP-1; C4orf49
NCBI Protein Information
protein MGARP
UniProt Protein Name
Protein MGARP
UniProt Gene Name
MGARP
UniProt Synonym Gene Names
C4orf49; CESP1; HUMMR; OSAP; CESP-1
UniProt Entry Name
HUMMR_HUMAN

Uniprot Description

OSAP: Plays a role in the trafficking of mitochondria along microtubules. Regulates the kinesin-mediated axonal transport of mitochondria to nerve terminals along microtubules during hypoxia. Participates in the translocation of TRAK2/GRIF1 from the cytoplasm to the mitochondrion. Also plays a role in steroidogenesis through maintenance of mitochondrial abundance and morphology.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 4q31.1

Cellular Component: integral to mitochondrial outer membrane; mitochondrion

Molecular Function: protein binding

Biological Process: anterograde axon cargo transport; axon transport of mitochondrion; protein targeting to mitochondrion; retrograde axon cargo transport

Research Articles on C4orf49

Similar Products

Product Notes

The C4orf49 mgarp (Catalog #AAA1278288) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGTATCTCC GCAGGGCGGT CTCCAAGACT CTGGCGCTGC CGCTGAGGGC GCCCCCCAAC CCCGCGCCGC TCGGAAAGGA CGCATCTCTG CGCCGGATGT CATCTAACAG ATTCCCTGGA TCATCTGGAT CAAATATGAT TTATTATCTG GTTGTAGGCG TCACAGTCAG TGCTGGTGGA TATTATGCTT ACAAGACAGT CACATCAGAC CAAGCCAAAC ACACAGAACA TAAAACAAAT TTGAAAGAAA AAACAAAAGC AGAGATACAT CCATTTCAAG GTGAAAAGGA GAATGTTGCG GAAACTGAGA AAGCAAGTTC AGAAGCCCCA GAAGAACTTA TAGTGGAAGC TGAGGTGGTA GATGCTGAAG AAAGTCCCAG TGCTACAGTT GTGGTCATAA AAGAGGCATC TGCCTGTCCA GGTCACGTGG AGGCTGCTCC GGAGACCACA GCAGTCAGTG CTGAAACCGG GCCAGAGGTC ACAGATGCAG CGGCGAGGGA AACCACGGAA GTAAACCCTG AAACAACCCC AGAGGTTACA AATGCTGCCC TGGATGAAGC TGTCACCATC GATAATGATA AAGATACAAC AAAGAACGAA ACCTCTGATG AATATGCTGA ACTAGAAGAA GAAAATTCTC CAGCTGAGTC AGAGTCCTCT GCTGGAGATG ATTTACAGGA GGAAGCCAGT GTTGGCTCTG AGGCTGCTTC GGCTCAAGGC TAA. It is sometimes possible for the material contained within the vial of "C4orf49, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.