Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

C4orf37 cdna clone

C4orf37 cDNA Clone

Gene Names
STPG2; C4orf37
Synonyms
C4orf37; C4orf37 cDNA Clone; C4orf37 cdna clone
Ordering
For Research Use Only!
Sequence
atgtatgatcgggctccccgcctgctcaaattggctgaaggtggcagcactgaggcccatgtgggtcctggatcctaccaggtacctttcctgaagcagcaggcgacaggtagtaatgcaccatttctttctttgactgccagagaaagtacttttaccattgcctctagcattgagaaagctgttccaggtccaggacactataatgtttcagaagcacagaaaatttcaagatcacctacacttaccagaagtgttgatgttccttcaattccttcttgtggaaagtcatatggttatcatattaatgatgatggcagtattataaaatgttttccacctgcttgtgacagtacacttggtccagcatactacaaacctcaatttgatgtttccaatgcaactttgaaatacaaaggtatacattttggcaactcttcaggaagacaagagttacctaaaaagtcaggtcctggtccaggacagtatgatatagtccagaaaaagacatcatattatgaaaatgttaacatcaagagagatcaacaacaaaattattgttcatttatcccacgactatatgaaataatagtattgcaggagaaaaaaaagagatttttacctatgaaatcaatcaccccggctcctggcacatataatgaacctcgaactgctctcaagtctttgaagaaaacatcaggactgaaaaatattccatttggtcaaagtgctgttcgattcacacaggacatcaggacagaggaaatgccaggtcctggattttataatgtcttgaacaatactataattgccagtgttagaaatatctgctcaaagaaacagaagaaaagtgcatttggttcttctgttcctcggactttcttctcggttcagaaagaagcttgtgctacccctggacctgctgattatcaggaattttggcattcacagggtgtgggaatttctgatgaattacctaacttgactaacaaatatgctgctttcttgtcaagagccaaaagaactatgaaagtaccagatatggttattccagcgccaggcagctatgatgttcacaaatcatatgagatgtcccaagttaagcataaatatatgccacctcgtagtttagtggctaaaagaaaacatgcctcttttcttagtgcaactcctcggtgcctagaaaaagtgactgatgggccaggtcctgcagcatacaatcctgttttaaggaaatcttgccccatacccttatttgtgaaagcatcaaagcgctttgaagagtccaaagagattactccaggcccagcaacatatgagatatcccaggagaaaaagaaaggaaatctcattggtgaaatggctgctgatataatgtga
Sequence Length
1380
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
50,660 Da
NCBI Official Full Name
Homo sapiens chromosome 4 open reading frame 37, mRNA
NCBI Official Synonym Full Names
sperm tail PG-rich repeat containing 2
NCBI Official Symbol
STPG2
NCBI Official Synonym Symbols
C4orf37
NCBI Protein Information
sperm-tail PG-rich repeat-containing protein 2
UniProt Protein Name
Sperm-tail PG-rich repeat-containing protein 2
UniProt Gene Name
STPG2
UniProt Synonym Gene Names
C4orf37
UniProt Entry Name
STPG2_HUMAN

Uniprot Description

STPG2:

Chromosomal Location of Human Ortholog: 4q22.3-q23

Research Articles on C4orf37

Similar Products

Product Notes

The C4orf37 stpg2 (Catalog #AAA1268947) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtatgatc gggctccccg cctgctcaaa ttggctgaag gtggcagcac tgaggcccat gtgggtcctg gatcctacca ggtacctttc ctgaagcagc aggcgacagg tagtaatgca ccatttcttt ctttgactgc cagagaaagt acttttacca ttgcctctag cattgagaaa gctgttccag gtccaggaca ctataatgtt tcagaagcac agaaaatttc aagatcacct acacttacca gaagtgttga tgttccttca attccttctt gtggaaagtc atatggttat catattaatg atgatggcag tattataaaa tgttttccac ctgcttgtga cagtacactt ggtccagcat actacaaacc tcaatttgat gtttccaatg caactttgaa atacaaaggt atacattttg gcaactcttc aggaagacaa gagttaccta aaaagtcagg tcctggtcca ggacagtatg atatagtcca gaaaaagaca tcatattatg aaaatgttaa catcaagaga gatcaacaac aaaattattg ttcatttatc ccacgactat atgaaataat agtattgcag gagaaaaaaa agagattttt acctatgaaa tcaatcaccc cggctcctgg cacatataat gaacctcgaa ctgctctcaa gtctttgaag aaaacatcag gactgaaaaa tattccattt ggtcaaagtg ctgttcgatt cacacaggac atcaggacag aggaaatgcc aggtcctgga ttttataatg tcttgaacaa tactataatt gccagtgtta gaaatatctg ctcaaagaaa cagaagaaaa gtgcatttgg ttcttctgtt cctcggactt tcttctcggt tcagaaagaa gcttgtgcta cccctggacc tgctgattat caggaatttt ggcattcaca gggtgtggga atttctgatg aattacctaa cttgactaac aaatatgctg ctttcttgtc aagagccaaa agaactatga aagtaccaga tatggttatt ccagcgccag gcagctatga tgttcacaaa tcatatgaga tgtcccaagt taagcataaa tatatgccac ctcgtagttt agtggctaaa agaaaacatg cctcttttct tagtgcaact cctcggtgcc tagaaaaagt gactgatggg ccaggtcctg cagcatacaa tcctgtttta aggaaatctt gccccatacc cttatttgtg aaagcatcaa agcgctttga agagtccaaa gagattactc caggcccagc aacatatgag atatcccagg agaaaaagaa aggaaatctc attggtgaaa tggctgctga tataatgtga. It is sometimes possible for the material contained within the vial of "C4orf37, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.