Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

C3orf25 cdna clone

C3orf25 cDNA Clone

Gene Names
EFCAB12; C3orf25
Synonyms
C3orf25; C3orf25 cDNA Clone; C3orf25 cdna clone
Ordering
For Research Use Only!
Sequence
atggacgacgactatgaagcgtaccacagtctgttcttgtcgctgctcggactctgcccgtctaagactcccatcaatgaaaatgctcccgtctttgatcctgaaccggtcattgcccactgcttcaagcagttccagcagaaggacttccgcctgcctcagacccgccggcgaatcatcatggtgcctcgcaaggaggatcagacaccccttaatcctgcatcccaacctcaggctcccccaaagcccatccccagcttcaaagttctggaagctagagatatccaagagcagccagaggacaggaagacctggctgagccagaggtcgaagctgcggcaggagctagagtcctttggtgatgtaaagaggtggctggagaacaagcccagcatcacgccttcagaggccaaggtcttacacatgatccacgaggagcagagtgcccagccaaatgcctcccaggcaactaccaggaccaccaggaagaaagcccccaggctctcccggctgtcccgccagatggtgccccagctccagctgcccgagccccctgccctgtcggtcatgtactcctacctgcatagccgcaagatcaagatcctggagatatttcacaaggtgggccagggtgagaaccagagaatcaccagggaggagttcatcgcggctgtaaaggcagtcggagtccctctgaagaaccaagaggtggaggatatagtgatctacctcagctctcttgggaagcacaacaccatcaccatggatatcctggccaatacctacaagcagtggtctatggctcagcaaaggagcagcctggccactgcaagggagcattatatcttggccaagcacagagattccctgaagggtccgctcaagaagcaggaggtggattcagccccacagcttcccaaagtggacctactgacggtgcctgcagtcgacacgcagatggagacgcggcccatgaccctggaggagatggaggaagtgggcaagcggtaccgcgagcggcagcgacagcacaagctcacgatcccctccatccagtacacggagcaatgtcacctggtgcgctgtgggaatcggcactttgatgagcactgcctcccgtccaccatccacggggatatgagggagctcattgactcggcccgcaggcacaactttctggtctacctgcaatgctggaagctctgtaagtcctatggcctcccgctgacagaggacatcctcatgaaagccttgctgtacccaggagacaagatcattttccagatggacaaagtgtgccccatccggcagccgggaggctactactctgactggaaggtcttttctccgaatctggctctgctccggtcccagggccctggcaagtctaagaggactgacaagaaaacgccaaagaaaagcaagaaaatgcgctttaaggagtttgaggaatttaccaggaagctgaaggtgaagaggtccagtggtctgcagcaaacacaccccaattccttctggccgggtcatcttctggataagctgcagctctacctgcccactgtggccacagaccggagcctggcgctcttcagttgtgttcaacaccagccccatgtctacccagccacctaccaccctgaccactggtggccccttaggaacaagaactacatgacccacgcccattatgatgccgccaaggtgtactacatcaactag
Sequence Length
1719
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
66,551 Da
NCBI Official Full Name
Homo sapiens chromosome 3 open reading frame 25, mRNA
NCBI Official Synonym Full Names
EF-hand calcium binding domain 12
NCBI Official Symbol
EFCAB12
NCBI Official Synonym Symbols
C3orf25
NCBI Protein Information
EF-hand calcium-binding domain-containing protein 12
UniProt Protein Name
EF-hand calcium-binding domain-containing protein 12
UniProt Gene Name
EFCAB12
UniProt Synonym Gene Names
C3orf25
UniProt Entry Name
EFC12_HUMAN

Uniprot Description

EFCAB12:

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 3q21.3

Molecular Function: protein binding

Research Articles on C3orf25

Similar Products

Product Notes

The C3orf25 efcab12 (Catalog #AAA1271148) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacgacg actatgaagc gtaccacagt ctgttcttgt cgctgctcgg actctgcccg tctaagactc ccatcaatga aaatgctccc gtctttgatc ctgaaccggt cattgcccac tgcttcaagc agttccagca gaaggacttc cgcctgcctc agacccgccg gcgaatcatc atggtgcctc gcaaggagga tcagacaccc cttaatcctg catcccaacc tcaggctccc ccaaagccca tccccagctt caaagttctg gaagctagag atatccaaga gcagccagag gacaggaaga cctggctgag ccagaggtcg aagctgcggc aggagctaga gtcctttggt gatgtaaaga ggtggctgga gaacaagccc agcatcacgc cttcagaggc caaggtctta cacatgatcc acgaggagca gagtgcccag ccaaatgcct cccaggcaac taccaggacc accaggaaga aagcccccag gctctcccgg ctgtcccgcc agatggtgcc ccagctccag ctgcccgagc cccctgccct gtcggtcatg tactcctacc tgcatagccg caagatcaag atcctggaga tatttcacaa ggtgggccag ggtgagaacc agagaatcac cagggaggag ttcatcgcgg ctgtaaaggc agtcggagtc cctctgaaga accaagaggt ggaggatata gtgatctacc tcagctctct tgggaagcac aacaccatca ccatggatat cctggccaat acctacaagc agtggtctat ggctcagcaa aggagcagcc tggccactgc aagggagcat tatatcttgg ccaagcacag agattccctg aagggtccgc tcaagaagca ggaggtggat tcagccccac agcttcccaa agtggaccta ctgacggtgc ctgcagtcga cacgcagatg gagacgcggc ccatgaccct ggaggagatg gaggaagtgg gcaagcggta ccgcgagcgg cagcgacagc acaagctcac gatcccctcc atccagtaca cggagcaatg tcacctggtg cgctgtggga atcggcactt tgatgagcac tgcctcccgt ccaccatcca cggggatatg agggagctca ttgactcggc ccgcaggcac aactttctgg tctacctgca atgctggaag ctctgtaagt cctatggcct cccgctgaca gaggacatcc tcatgaaagc cttgctgtac ccaggagaca agatcatttt ccagatggac aaagtgtgcc ccatccggca gccgggaggc tactactctg actggaaggt cttttctccg aatctggctc tgctccggtc ccagggccct ggcaagtcta agaggactga caagaaaacg ccaaagaaaa gcaagaaaat gcgctttaag gagtttgagg aatttaccag gaagctgaag gtgaagaggt ccagtggtct gcagcaaaca caccccaatt ccttctggcc gggtcatctt ctggataagc tgcagctcta cctgcccact gtggccacag accggagcct ggcgctcttc agttgtgttc aacaccagcc ccatgtctac ccagccacct accaccctga ccactggtgg ccccttagga acaagaacta catgacccac gcccattatg atgccgccaa ggtgtactac atcaactag. It is sometimes possible for the material contained within the vial of "C3orf25, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.