C3orf17 cdna clone
C3orf17 cDNA Clone
Gene Names
NEPRO; NET17; C3orf17
Synonyms
C3orf17; C3orf17 cDNA Clone; C3orf17 cdna clone
Sequence
atgatggctgcggtgccgccgggcctggagccgtggaaccgtgtgagaatccctaaggcggggaaccgcagcgcagtgacagtgcagaaccccggcgcggccattgacctttgcattgcagctgtaattaaagaatgccatctcgtcatactgtcgctgaagagccaaaccttagatgcagaaacagatgtgttatgtgcagtcctttacagcaatcacaacagaatgggccgccacaaaccccatttggccctcaaacaggttgagcaatgtttaaagcgtttgaaaaacatgaatttggagggctcaattcaagacctgtttgagttgttttcttccaatgaaaatcagcccttaactaccaaagtatgtgttgtccccagtcagccagtggtggagttggtgttgatgaaggttttgggagcctgcaagttgttgctccgcttgttggactgctgctgcaaaacttttcttttgactgtgaaacatctaggtttgcaagagttcattattttaaaccttgtgatggttgggctggtgagcaggttatgggttctctataaaggtgtcttaaaaaggttgattttgttatatgagcctttgtttggattgcttcaagaggtcgctaggattcaaccaatgccttacttcaaagattttacctttccttctgatatcactgaatttttaggacagccatattttgaagcctttaagaaaaaaatgcctatagcttttgcagctaaaggaataaataaattgctaaataaactgtttttaataaatgagcagtcaccaagagccagtgaagaaaccttgcttggaatttcaaaaaaagctaaacaaatgaagatcaatgtacagaataatgtggatcttggacagccagtaaagaataagagagtcttcaaagaagagtcatcagaatttgatgtgagggctttctgcaaccagctgaaacacaaagctactcaggagaccagttttgattttaaatgttctcaatccagactaaagacaaccaagtattcttctcagaaagtgataggaactcctcatgccaaaagtattgtgcaaagattccgagaggctgagtccttcacacaactttctgaagaaatccagatggcagttgtatggtgcaggagcaaaaaactcaaggctcaggccatttttctgggtaacaaacttcttaaaagcaaccggcttaaacatctggaagctcaaggtactagtttgccaaagaaactagagtgcataaaaacgtctatttgcaaccaccttcttcgtggctcaggtatcaaaacttcaaagcatcatctgagacagagaagatcacagaataaatttttacggagacaaaggaaaccacagagaaagttgcagtcgactcttttaagggaaattcagcagttctctcaagggactcggaagagtgctacagataccagtgctaagtggagactctcacactgtactgtgcatagaactgatctctaccctaacagtaagcagctcttgaataatggagtttcaatgcctgtcatacaaactaaggggaaaatgattcatgaaaatcttagaggcatccatgaaaatgaaactgattcgtggacggtgatgcaaataaataaaaacagtacatcaggaaccattaaggagacagatgacattgatgatatttttgctttaatgggagtttag
Sequence Length
1704
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
56,749 Da
NCBI Official Full Name
Homo sapiens chromosome 3 open reading frame 17, mRNA
NCBI Official Synonym Full Names
nucleolus and neural progenitor protein
NCBI Official Symbol
NEPRO
NCBI Official Synonym Symbols
NET17; C3orf17
NCBI Protein Information
protein nepro homolog
UniProt Protein Name
Protein nepro homolog
UniProt Gene Name
NEPRO
UniProt Entry Name
NEPRO_HUMAN
Uniprot Description
C3orf17: 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral
Chromosomal Location of Human Ortholog: 3q13.2
Cellular Component: nucleolus; nucleus
Biological Process: negative regulation of neuron differentiation; positive regulation of Notch signaling pathway
Similar Products
Product Notes
The C3orf17 nepro (Catalog #AAA1271364) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatggctg cggtgccgcc gggcctggag ccgtggaacc gtgtgagaat ccctaaggcg gggaaccgca gcgcagtgac agtgcagaac cccggcgcgg ccattgacct ttgcattgca gctgtaatta aagaatgcca tctcgtcata ctgtcgctga agagccaaac cttagatgca gaaacagatg tgttatgtgc agtcctttac agcaatcaca acagaatggg ccgccacaaa ccccatttgg ccctcaaaca ggttgagcaa tgtttaaagc gtttgaaaaa catgaatttg gagggctcaa ttcaagacct gtttgagttg ttttcttcca atgaaaatca gcccttaact accaaagtat gtgttgtccc cagtcagcca gtggtggagt tggtgttgat gaaggttttg ggagcctgca agttgttgct ccgcttgttg gactgctgct gcaaaacttt tcttttgact gtgaaacatc taggtttgca agagttcatt attttaaacc ttgtgatggt tgggctggtg agcaggttat gggttctcta taaaggtgtc ttaaaaaggt tgattttgtt atatgagcct ttgtttggat tgcttcaaga ggtcgctagg attcaaccaa tgccttactt caaagatttt acctttcctt ctgatatcac tgaattttta ggacagccat attttgaagc ctttaagaaa aaaatgccta tagcttttgc agctaaagga ataaataaat tgctaaataa actgttttta ataaatgagc agtcaccaag agccagtgaa gaaaccttgc ttggaatttc aaaaaaagct aaacaaatga agatcaatgt acagaataat gtggatcttg gacagccagt aaagaataag agagtcttca aagaagagtc atcagaattt gatgtgaggg ctttctgcaa ccagctgaaa cacaaagcta ctcaggagac cagttttgat tttaaatgtt ctcaatccag actaaagaca accaagtatt cttctcagaa agtgatagga actcctcatg ccaaaagtat tgtgcaaaga ttccgagagg ctgagtcctt cacacaactt tctgaagaaa tccagatggc agttgtatgg tgcaggagca aaaaactcaa ggctcaggcc atttttctgg gtaacaaact tcttaaaagc aaccggctta aacatctgga agctcaaggt actagtttgc caaagaaact agagtgcata aaaacgtcta tttgcaacca ccttcttcgt ggctcaggta tcaaaacttc aaagcatcat ctgagacaga gaagatcaca gaataaattt ttacggagac aaaggaaacc acagagaaag ttgcagtcga ctcttttaag ggaaattcag cagttctctc aagggactcg gaagagtgct acagatacca gtgctaagtg gagactctca cactgtactg tgcatagaac tgatctctac cctaacagta agcagctctt gaataatgga gtttcaatgc ctgtcataca aactaagggg aaaatgattc atgaaaatct tagaggcatc catgaaaatg aaactgattc gtggacggtg atgcaaataa ataaaaacag tacatcagga accattaagg agacagatga cattgatgat atttttgctt taatgggagt ttag. It is sometimes possible for the material contained within the vial of "C3orf17, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
