C2orf43 cdna clone
C2orf43 cDNA Clone
Gene Names
LDAH; hLDAH; C2orf43
Synonyms
C2orf43; C2orf43 cDNA Clone; C2orf43 cdna clone
Sequence
atggactcagaactcaaggaagaaattcctgtgcatgaggaattcattttgtgtggtggagccgaaacccaggttctaaaatgtgggccctggacagacctctttcatgatcaaagtgtcaaaaggcctaagctgcttattttcattattcctggtaacccaggtttttctgccttttatgtgccatttgcaaaggctttatactctttgacaaacagacgctttccagtttggactatcagtcatgctgggcatgcgttggctcccaaagacaagaagattcttacaacatcagaggattcaaacgctcaagaaattaaggacatttatggactaaatggacaaatagagcacaaactagctttcctgagaactcatgtgccaaaggacatgaaacttgtgctcattggccattcaataggcagctatttcacacttcagatgctgaagcgagtccctgagctcccggtaattcgtgcctttctgctctttccaacaattgaacgaatgtctgagtcacccaatggcagaattgccactccacttttgtgctggtttcgatatgttctctatgttactggctacttattattgaaaccgtgtcctgagacaatcaagtccttgctaatcagaaggggccttcaagtaatgaacctagagaatgaattttcaccattgaatatattagaaccattctgccttgctaatgctgcctaccttgggggccaagaaatgatggaggtggtgaagagagatgacgaaaccataaaggagcatttatgtaagcttacattttattatggtactatagatccttggtgtccaaaagagtactatgaagacattaagaaggattttccagaaggagacattcgactctgtgagaaaaacatacctcatgctttcatcacccattttaaccaggaaatggcagacatgattgctgactccctaaaggatgacttgtccaaaatgtaa
Sequence Length
978
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
22,663 Da
NCBI Official Full Name
Homo sapiens chromosome 2 open reading frame 43, mRNA
NCBI Official Synonym Full Names
lipid droplet associated hydrolase
NCBI Official Symbol
LDAH
NCBI Official Synonym Symbols
hLDAH; C2orf43
NCBI Protein Information
lipid droplet-associated hydrolase
UniProt Protein Name
Lipid droplet-associated hydrolase
UniProt Gene Name
LDAH
UniProt Synonym Gene Names
hLDAH
UniProt Entry Name
LDAH_HUMAN
Uniprot Description
LDAH: Belongs to the UPF0554 family. 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 2p24.1
Cellular Component: lipid particle
Molecular Function: lipase activity
Biological Process: sequestering of lipid
Research Articles on C2orf43
Similar Products
Product Notes
The C2orf43 ldah (Catalog #AAA1274784) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggactcag aactcaagga agaaattcct gtgcatgagg aattcatttt gtgtggtgga gccgaaaccc aggttctaaa atgtgggccc tggacagacc tctttcatga tcaaagtgtc aaaaggccta agctgcttat tttcattatt cctggtaacc caggtttttc tgccttttat gtgccatttg caaaggcttt atactctttg acaaacagac gctttccagt ttggactatc agtcatgctg ggcatgcgtt ggctcccaaa gacaagaaga ttcttacaac atcagaggat tcaaacgctc aagaaattaa ggacatttat ggactaaatg gacaaataga gcacaaacta gctttcctga gaactcatgt gccaaaggac atgaaacttg tgctcattgg ccattcaata ggcagctatt tcacacttca gatgctgaag cgagtccctg agctcccggt aattcgtgcc tttctgctct ttccaacaat tgaacgaatg tctgagtcac ccaatggcag aattgccact ccacttttgt gctggtttcg atatgttctc tatgttactg gctacttatt attgaaaccg tgtcctgaga caatcaagtc cttgctaatc agaaggggcc ttcaagtaat gaacctagag aatgaatttt caccattgaa tatattagaa ccattctgcc ttgctaatgc tgcctacctt gggggccaag aaatgatgga ggtggtgaag agagatgacg aaaccataaa ggagcattta tgtaagctta cattttatta tggtactata gatccttggt gtccaaaaga gtactatgaa gacattaaga aggattttcc agaaggagac attcgactct gtgagaaaaa catacctcat gctttcatca cccattttaa ccaggaaatg gcagacatga ttgctgactc cctaaaggat gacttgtcca aaatgtaa. It is sometimes possible for the material contained within the vial of "C2orf43, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
