C2orf18 cdna clone
C2orf18 cDNA Clone
Gene Names
SLC35F6; ANT2BP; TANGO9; C2orf18
Synonyms
C2orf18; C2orf18 cDNA Clone; C2orf18 cdna clone
Sequence
atggcctggaccaagtaccagctgttcctggccgggctcatgcttgttaccggctccatcaacacgctctcggcaaaatgggcggacaatttcatggccgagggctgtggagggagcaaggagcacagcttccagcatcccttcctccaggcagtgggcatgttcctgggagaattctcctgcctggctgccttctacctcctccgatgcagagctgcagggcaatcagactccagcgtagacccccagcagcccttcaaccctcttcttttcctgcccccagcgctctgtgacatgacagggaccagcctcatgtatgtggctctgaacatgaccagtgcctccagcttccagatgctgcggggtgcagtgatcatattcactggcctgttctcggtggccttcctgggccggaggctggtgctgagccagtggctgggcatcctagccaccatcgcggggctggtggtcgtgggcctggctgacctcctgagcaagcacgacagtcagcacaagctcagcgaagtgatcacaggggacctgttgatcatcatggcccagatcatcgttgccatccagatggtgctagaggagaagttcgtctacaaacacaatgtgcacccactgcgggcagttggcactgagggcctctttggctttgtgatcctctccctgctgctggtgcccatgtactacatccccgccggctccttcagcggaaaccctcgtgggacactggaggatgcattggacgccttctgccaggtgggccagcagccgctcattgccgtggcactgctgggcaacatcagcagcattgccttcttcaacttcgcaggcatcagcgtcaccaaggaactgagcgccaccacccgcatggtgttggacagcttgcgcaccgttgtcatctgggcactgagcctggcactgggctgggaggccttccatgcactgcagatccttggcttcctcatactccttataggcactgccctctacaatgggctacaccgtccgctgctgggccgcctgtccaggggccggcccctggcagaggagagcgagcaggagagactgctgggtggcacccgcactcccatcaatgatgccagctga
Sequence Length
1116
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
40,214 Da
NCBI Official Full Name
Homo sapiens chromosome 2 open reading frame 18, mRNA
NCBI Official Synonym Full Names
solute carrier family 35 member F6
NCBI Official Symbol
SLC35F6
NCBI Official Synonym Symbols
ANT2BP; TANGO9; C2orf18
NCBI Protein Information
solute carrier family 35 member F6
UniProt Protein Name
Solute carrier family 35 member F6
UniProt Gene Name
SLC35F6
UniProt Synonym Gene Names
C2orf18; ANT2BP
UniProt Entry Name
S35F6_HUMAN
Uniprot Description
SLC35F6: Involved in the maintenance of mitochondrial membrane potential in pancreatic ductal adenocarcinoma (PDAC) cells. Promotes pancreatic ductal adenocarcinoma (PDAC) cell growth. May play a role as a nucleotide-sugar transporter. Belongs to the SLC35F solute transporter family. Interacts with SLC25A5
Protein type: Membrane protein, multi-pass; Membrane protein, integral
Chromosomal Location of Human Ortholog: 2p23.3
Cellular Component: lysosomal membrane; mitochondrion
Molecular Function: protein binding
Biological Process: positive regulation of cell proliferation
Research Articles on C2orf18
Similar Products
Product Notes
The C2orf18 slc35f6 (Catalog #AAA1266925) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcctgga ccaagtacca gctgttcctg gccgggctca tgcttgttac cggctccatc aacacgctct cggcaaaatg ggcggacaat ttcatggccg agggctgtgg agggagcaag gagcacagct tccagcatcc cttcctccag gcagtgggca tgttcctggg agaattctcc tgcctggctg ccttctacct cctccgatgc agagctgcag ggcaatcaga ctccagcgta gacccccagc agcccttcaa ccctcttctt ttcctgcccc cagcgctctg tgacatgaca gggaccagcc tcatgtatgt ggctctgaac atgaccagtg cctccagctt ccagatgctg cggggtgcag tgatcatatt cactggcctg ttctcggtgg ccttcctggg ccggaggctg gtgctgagcc agtggctggg catcctagcc accatcgcgg ggctggtggt cgtgggcctg gctgacctcc tgagcaagca cgacagtcag cacaagctca gcgaagtgat cacaggggac ctgttgatca tcatggccca gatcatcgtt gccatccaga tggtgctaga ggagaagttc gtctacaaac acaatgtgca cccactgcgg gcagttggca ctgagggcct ctttggcttt gtgatcctct ccctgctgct ggtgcccatg tactacatcc ccgccggctc cttcagcgga aaccctcgtg ggacactgga ggatgcattg gacgccttct gccaggtggg ccagcagccg ctcattgccg tggcactgct gggcaacatc agcagcattg ccttcttcaa cttcgcaggc atcagcgtca ccaaggaact gagcgccacc acccgcatgg tgttggacag cttgcgcacc gttgtcatct gggcactgag cctggcactg ggctgggagg ccttccatgc actgcagatc cttggcttcc tcatactcct tataggcact gccctctaca atgggctaca ccgtccgctg ctgggccgcc tgtccagggg ccggcccctg gcagaggaga gcgagcagga gagactgctg ggtggcaccc gcactcccat caatgatgcc agctga. It is sometimes possible for the material contained within the vial of "C2orf18, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
