Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

C22orf25 cdna clone

C22orf25 cDNA Clone

Gene Names
TANGO2; MECRCN; C22orf25
Synonyms
C22orf25; C22orf25 cDNA Clone; C22orf25 cdna clone
Ordering
For Research Use Only!
Sequence
atgtgcatcatcttctttaagtttgatcctcgccctgtttccaaaaacgcgtacaggctcatcttggcagccaacagggatgaattctacagccgaccctccaagttagctgacttctgggggaacaacaacgagatcctcagtgggctggacatggaggaaggcaaggaaggaggcacatggctgggcatcagcacacgtggcaagctggcagcactcaccaactacctgcagccgcagctggactggcaggcccgagggcgaggtgaacttgtcacccactttctgaccactgacgtggacagcttgtcctacctgaagaaggtctctatggagggccatctgtacaatggcttcaacctcatagcagccaacctgagcacagcaaagggagacgtcatttgctactatgggaaccgaggggagcctgatcctatcgttttgacgccaggcacctacgggctgagcaacgcgctgctggagactccctggaggaagctgtgctttgggaagcagctcttcctggaggctgtggaacggagccaggcgctgcccaaggatgtgctcatcgccagcctcctggatgtgctcaacaataaagaggcgcagctgccagacccggccatcgaggaccagggtggggagtacgtgcagcccatgctgagcaagtacgcggctgtgtgcgtgcgctgccctggctacggcaccagaaccaacactatcatcctggtagatgcggacggccacgtgaccttcactgagcgtagcatgatggacaaggacctctcccactgggagaccagaacctatgagttcacactgcagagctaa
Sequence Length
831
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,628 Da
NCBI Official Full Name
Homo sapiens chromosome 22 open reading frame 25, mRNA
NCBI Official Synonym Full Names
transport and golgi organization 2 homolog
NCBI Official Symbol
TANGO2
NCBI Official Synonym Symbols
MECRCN; C22orf25
NCBI Protein Information
transport and Golgi organization protein 2 homolog
UniProt Protein Name
Transport and Golgi organization protein 2 homolog
UniProt Gene Name
TANGO2
UniProt Synonym Gene Names
C22orf25
UniProt Entry Name
TNG2_HUMAN

NCBI Description

This gene belongs to the transport and Golgi organization family, whose members are predicted to play roles in secretory protein loading in the endoplasmic reticulum. Depletion of this gene in Drosophila S2 cells causes fusion of the Golgi with the ER. In mouse tissue culture cells, this protein co-localizes with a mitochondrially targeted mCherry protein and displays very low levels of co-localization with Golgi and peroxisomes. Allelic variants of this gene are associated with rhabdomyolysis, metabolic crises with encephalopathy, and cardiac arrhythmia. [provided by RefSeq, Apr 2016]

Uniprot Description

TANGO2: 3 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 22q11.21

Disease: Metabolic Encephalomyopathic Crises, Recurrent, With Rhabdomyolysis, Cardiac Arrhythmias, And Neurodegeneration

Research Articles on C22orf25

Similar Products

Product Notes

The C22orf25 tango2 (Catalog #AAA1272349) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgcatca tcttctttaa gtttgatcct cgccctgttt ccaaaaacgc gtacaggctc atcttggcag ccaacaggga tgaattctac agccgaccct ccaagttagc tgacttctgg gggaacaaca acgagatcct cagtgggctg gacatggagg aaggcaagga aggaggcaca tggctgggca tcagcacacg tggcaagctg gcagcactca ccaactacct gcagccgcag ctggactggc aggcccgagg gcgaggtgaa cttgtcaccc actttctgac cactgacgtg gacagcttgt cctacctgaa gaaggtctct atggagggcc atctgtacaa tggcttcaac ctcatagcag ccaacctgag cacagcaaag ggagacgtca tttgctacta tgggaaccga ggggagcctg atcctatcgt tttgacgcca ggcacctacg ggctgagcaa cgcgctgctg gagactccct ggaggaagct gtgctttggg aagcagctct tcctggaggc tgtggaacgg agccaggcgc tgcccaagga tgtgctcatc gccagcctcc tggatgtgct caacaataaa gaggcgcagc tgccagaccc ggccatcgag gaccagggtg gggagtacgt gcagcccatg ctgagcaagt acgcggctgt gtgcgtgcgc tgccctggct acggcaccag aaccaacact atcatcctgg tagatgcgga cggccacgtg accttcactg agcgtagcat gatggacaag gacctctccc actgggagac cagaacctat gagttcacac tgcagagcta a. It is sometimes possible for the material contained within the vial of "C22orf25, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.