C1orf201 cdna clone
C1orf201 cDNA Clone
Gene Names
STPG1; MAPO2; C1orf201
Synonyms
C1orf201; C1orf201 cDNA Clone; C1orf201 cdna clone
Sequence
atgtttccctcaatgtgcgcccgattggacaccatcatttctaaataccctgcagcgaatgcatacactatcccatcggattttatttccaagagagactttagtaattcgtgttccagcatgttccagttgccaagctttatgaaagctctcaagtttgaaactcctgcaccaaactattacaatgcctctgtctcttgctgcaagcagagaaacaacgtctgtactcgagccgggtttatgtcaaaaacccaaagaggatctttcgcttttgctgataaaggacctcccccagggcattatgatatcaacgaatcccttgtgaagcagtcgccaaatacattaatgtcttgttttaaatcaaaaaccaaccgtggattaaaactgacgtcaacaggcccgggacctggttattacaaccccagtgattgcacaaaagttccaaaaaagactcttttcccgaaaaaccccatcctgaacttctctgctcagccttcgcctctgcctccgaagccacctttcccaggtcctggtcagtatgagatcgtggactacttaggcccccgcaagcatttcatctctagtgcatcattcgtgtccaataccagccggtggacagcggcgccgcctcagccaggcctgcctggcccagctacgtacaagccagagcttccaggaaagcagtccttcctctacaacgaggacaagaaatggatcccggttctgtag
Sequence Length
729
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
31,539 Da
NCBI Official Full Name
Homo sapiens chromosome 1 open reading frame 201, mRNA
NCBI Official Synonym Full Names
sperm tail PG-rich repeat containing 1
NCBI Official Symbol
STPG1
NCBI Official Synonym Symbols
MAPO2; C1orf201
NCBI Protein Information
O(6)-methylguanine-induced apoptosis 2
UniProt Protein Name
O(6)-methylguanine-induced apoptosis 2
UniProt Gene Name
STPG1
UniProt Synonym Gene Names
C1orf201; MAPO2
UniProt Entry Name
STPG1_HUMAN
Uniprot Description
LOC90529: Belongs to the STPG1 family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 1p36.11
Research Articles on C1orf201
Similar Products
Product Notes
The C1orf201 stpg1 (Catalog #AAA1268715) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtttccct caatgtgcgc ccgattggac accatcattt ctaaataccc tgcagcgaat gcatacacta tcccatcgga ttttatttcc aagagagact ttagtaattc gtgttccagc atgttccagt tgccaagctt tatgaaagct ctcaagtttg aaactcctgc accaaactat tacaatgcct ctgtctcttg ctgcaagcag agaaacaacg tctgtactcg agccgggttt atgtcaaaaa cccaaagagg atctttcgct tttgctgata aaggacctcc cccagggcat tatgatatca acgaatccct tgtgaagcag tcgccaaata cattaatgtc ttgttttaaa tcaaaaacca accgtggatt aaaactgacg tcaacaggcc cgggacctgg ttattacaac cccagtgatt gcacaaaagt tccaaaaaag actcttttcc cgaaaaaccc catcctgaac ttctctgctc agccttcgcc tctgcctccg aagccacctt tcccaggtcc tggtcagtat gagatcgtgg actacttagg cccccgcaag catttcatct ctagtgcatc attcgtgtcc aataccagcc ggtggacagc ggcgccgcct cagccaggcc tgcctggccc agctacgtac aagccagagc ttccaggaaa gcagtccttc ctctacaacg aggacaagaa atggatcccg gttctgtag. It is sometimes possible for the material contained within the vial of "C1orf201, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
