C1orf174 cdna clone
C1orf174 cDNA Clone
Synonyms
C1orf174; C1orf174 cDNA Clone; C1orf174 cdna clone
Sequence
atgaggagccggaagctcacaggtgcagtgcggtcttcagcgcgcttgaaagcacgaagttgttcggcagccaggttggcctctgcccaggaagttgctggttccacgtctgccaagacagcatgtctgacttcctcatcccacaaagccacagacaggcgaacgtccaagaagttcaaatgtgacaaaggacatcttgtgaagtcagaattacagaagcttgtccctaagaatgacagcgcttctttgccaaaagtgacacctgagaccccttgtgaaaatgagtttgctgaaggcagtgccttgcttccaggcagcgaggctggcgtttctgtgcagcagggggctgcaagtcttcctctcggtggctgcagagttgtgagtgactctcgcttagcaaagactagagatggcctgtccgtgccaaaacacagtgccgggtccggagcagaagaatccaacagcagctccactgtgcagaagcagaatgagccagggctacagacagaggatgtgcagaagccaccacttcagatggacaacagcgtctttctagatgacgacagcaatcagccaatgcccgtgagccggttctttggaaacgttgagctcatgcaggacctcccacctgcgtcttcatcttgtccttcaatgagcagacgagagttcagaaaaatgcatttcagagccaaagatgatgatgatgacgacgacgatgatgcagaaatgtag
Sequence Length
732
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
25,977 Da
NCBI Official Full Name
Homo sapiens chromosome 1 open reading frame 174, mRNA
NCBI Official Synonym Full Names
chromosome 1 open reading frame 174
NCBI Official Symbol
C1orf174
NCBI Protein Information
UPF0688 protein C1orf174
UniProt Protein Name
UPF0688 protein C1orf174
Protein Family
UniProt Gene Name
C1orf174
UniProt Entry Name
CA174_HUMAN
Uniprot Description
C1orf174: Belongs to the UPF0688 family.
Chromosomal Location of Human Ortholog: 1p36.32
Cellular Component: nucleus
Molecular Function: protein binding
Similar Products
Product Notes
The C1orf174 c1orf174 (Catalog #AAA1270208) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaggagcc ggaagctcac aggtgcagtg cggtcttcag cgcgcttgaa agcacgaagt tgttcggcag ccaggttggc ctctgcccag gaagttgctg gttccacgtc tgccaagaca gcatgtctga cttcctcatc ccacaaagcc acagacaggc gaacgtccaa gaagttcaaa tgtgacaaag gacatcttgt gaagtcagaa ttacagaagc ttgtccctaa gaatgacagc gcttctttgc caaaagtgac acctgagacc ccttgtgaaa atgagtttgc tgaaggcagt gccttgcttc caggcagcga ggctggcgtt tctgtgcagc agggggctgc aagtcttcct ctcggtggct gcagagttgt gagtgactct cgcttagcaa agactagaga tggcctgtcc gtgccaaaac acagtgccgg gtccggagca gaagaatcca acagcagctc cactgtgcag aagcagaatg agccagggct acagacagag gatgtgcaga agccaccact tcagatggac aacagcgtct ttctagatga cgacagcaat cagccaatgc ccgtgagccg gttctttgga aacgttgagc tcatgcagga cctcccacct gcgtcttcat cttgtccttc aatgagcaga cgagagttca gaaaaatgca tttcagagcc aaagatgatg atgatgacga cgacgatgat gcagaaatgt ag. It is sometimes possible for the material contained within the vial of "C1orf174, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
