Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

C1GALT1C1 cdna clone

C1GALT1C1 cDNA Clone

Gene Names
C1GALT1C1; TNPS; COSMC; MST143; C1GALT2; HSPC067; C38H2-L1
Synonyms
C1GALT1C1; C1GALT1C1 cDNA Clone; C1GALT1C1 cdna clone
Ordering
For Research Use Only!
Sequence
atgctttctgaaagcagctcctttttgaagggtgtgatgcttggaagcattttctgtgctttgatcactatgctaggacacattaggattggtcatggaaatagaatgcaccaccatgagcatcatcacctacaagctcctaacaaagaagatatcttgaaaatttcagaggatgagcgcatggagctcagtaagagctttcgagtatactgtattatccttgtaaaacccaaagatgtgagtctttgggctgcagtaaaggagacttggaccaaacactgtgacaaagcagagttcttcagttctgaaaatgttaaagtgtttgagtcaattaatatggacacaaatgacatgtggttaatgatgagaaaagcttacaaatacgcctttgataagtatagagaccaatacaactggttcttccttgcacgccccactacgtttgctatcattgaaaacctaaagtattttttgttaaaaaaggatccatcacagcctttctatctaggccacactataaaatctggagaccttgaatatgtgggtatggaaggaggaattgtcttaagtgtagaatcaatgaaaagacttaacagccttctcaatatcccagaaaagtgtcctgaacagggagggatgatttggaagatatctgaagataaacagctagcagtttgcctgaaatatgctggagtatttgcagaaaatgcagaagatgctgatggaaaagatgtatttaataccaaatctgttgggctttctattaaagaggcaatgacttatcaccccaaccaggtagtagaaggctgttgttcagatatggctgttacttttaatggactgactccaaatcagatgcatgtgatgatgtatggggtataccgccttagggcatttgggcatattttcaatgatgcattggttttcttacctccaaatggttctgacaatgactga
Sequence Length
957
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,382 Da
NCBI Official Full Name
Homo sapiens C1GALT1-specific chaperone 1, mRNA
NCBI Official Synonym Full Names
C1GALT1 specific chaperone 1
NCBI Official Symbol
C1GALT1C1
NCBI Official Synonym Symbols
TNPS; COSMC; MST143; C1GALT2; HSPC067; C38H2-L1
NCBI Protein Information
C1GALT1-specific chaperone 1
UniProt Protein Name
C1GALT1-specific chaperone 1
UniProt Gene Name
C1GALT1C1
UniProt Synonym Gene Names
COSMC; C38H2-L1; C1Gal-T2; C1GalT2; Core 1 beta3-Gal-T2
UniProt Entry Name
C1GLC_HUMAN

NCBI Description

This gene encodes a type II transmembrane protein that is similar to the core 1 beta1,3-galactosyltransferase 1, which catalyzes the synthesis of the core-1 structure, also known as Thomsen-Friedenreich antigen, on O-linked glycans. This gene product lacks the galactosyltransferase activity itself, but instead acts as a molecular chaperone required for the folding, stability and full activity of the core 1 beta1,3-galactosyltransferase 1. Mutations in this gene have been associated with Tn syndrome. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Dec 2009]

Uniprot Description

C1GALT1C1: Probable chaperone required for the generation of 1 O- glycan Gal-beta1-3GalNAc-alpha1-Ser/Thr (T antigen), which is a precursor for many extended O-glycans in glycoproteins. Probably acts as a specific molecular chaperone assisting the folding/stability of core 1 beta-3-galactosyltransferase (C1GALT1). Defects in C1GALT1C1 are the cause of Tn syndrome (TNSYN). Tn syndrome is a rare autoimmune disease caused by somatic mutation in the C1GALT1C1 gene in which subpopulations of blood cells of all lineages carry an incompletely glycosylated membrane glycoprotein, i.e. the Tn antigen. Since leukocytes and platelets are affected as well as red cells, anemia, leukopenia and thrombocytopenia are features. Tn-polyagglutinability is sometimes associated with leukemia or is a preleukemic state. Belongs to the glycosyltransferase 31 family. Beta3- Gal-T subfamily.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: Xq24

Cellular Component: Golgi membrane

Molecular Function: glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase activity; protein binding

Biological Process: O-glycan processing; O-glycan processing, core 1; protein amino acid O-linked glycosylation

Disease: Tn Polyagglutination Syndrome

Research Articles on C1GALT1C1

Similar Products

Product Notes

The C1GALT1C1 c1galt1c1 (Catalog #AAA1272931) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctttctg aaagcagctc ctttttgaag ggtgtgatgc ttggaagcat tttctgtgct ttgatcacta tgctaggaca cattaggatt ggtcatggaa atagaatgca ccaccatgag catcatcacc tacaagctcc taacaaagaa gatatcttga aaatttcaga ggatgagcgc atggagctca gtaagagctt tcgagtatac tgtattatcc ttgtaaaacc caaagatgtg agtctttggg ctgcagtaaa ggagacttgg accaaacact gtgacaaagc agagttcttc agttctgaaa atgttaaagt gtttgagtca attaatatgg acacaaatga catgtggtta atgatgagaa aagcttacaa atacgccttt gataagtata gagaccaata caactggttc ttccttgcac gccccactac gtttgctatc attgaaaacc taaagtattt tttgttaaaa aaggatccat cacagccttt ctatctaggc cacactataa aatctggaga ccttgaatat gtgggtatgg aaggaggaat tgtcttaagt gtagaatcaa tgaaaagact taacagcctt ctcaatatcc cagaaaagtg tcctgaacag ggagggatga tttggaagat atctgaagat aaacagctag cagtttgcct gaaatatgct ggagtatttg cagaaaatgc agaagatgct gatggaaaag atgtatttaa taccaaatct gttgggcttt ctattaaaga ggcaatgact tatcacccca accaggtagt agaaggctgt tgttcagata tggctgttac ttttaatgga ctgactccaa atcagatgca tgtgatgatg tatggggtat accgccttag ggcatttggg catattttca atgatgcatt ggttttctta cctccaaatg gttctgacaa tgactga. It is sometimes possible for the material contained within the vial of "C1GALT1C1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.