C16orf73 cdna clone
C16orf73 cDNA Clone
Gene Names
MEIOB; gs129; C16orf73
Synonyms
C16orf73; C16orf73 cDNA Clone; C16orf73 cdna clone
Sequence
atgacagcaactgtaatctcaaaaaccattattacaactaatccagatataccagaagctaacattctgctgaattttatacgagaaaataaagaaacaaatgttctggatgatgaaattgacagttatttcaaagaatccataaatttaagtacaatagttgatgtctacacagttgaacaattaaagggaaaagctttgaagaatgaaggaaaagctgatccttcctatggcatcctttatgcctacatttccacactcaacattgatgatgaaactacaaaagtagttcgaaatagatgttccagctgtggttatattgtaaatgaagcatctaacatgtgcacaacttgcaacaaaaactccttggactttaaatctgtctttctcagtttccatgtgctgattgatctgactgatcacacaggcacccttcattcctgtagtctcacaggaagtgttgctgaggagactttgggctgcacgttcgttctatcacacagagcaaggagtggattgaaaattagtgtactctcgtgcaagcttgcagatcctactgaggcaagcagaaacttgtctggacaaaaacatgtttaa
Sequence Length
597
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
52,862 Da
NCBI Official Full Name
Homo sapiens chromosome 16 open reading frame 73, mRNA
NCBI Official Synonym Full Names
meiosis specific with OB domains
NCBI Official Symbol
MEIOB
NCBI Official Synonym Symbols
gs129; C16orf73
NCBI Protein Information
meiosis-specific with OB domain-containing protein
UniProt Protein Name
Meiosis-specific with OB domain-containing protein
UniProt Gene Name
MEIOB
UniProt Synonym Gene Names
C16orf73
UniProt Entry Name
MEIOB_HUMAN
Uniprot Description
MEIOB: May be involved in early meiosis.
Chromosomal Location of Human Ortholog: 16p13.3
Cellular Component: cytoplasm
Molecular Function: chromatin binding; single-stranded DNA binding; single-stranded DNA specific 3'-5' exodeoxyribonuclease activity
Biological Process: double-strand break repair via homologous recombination; female meiosis I; fertilization; male meiosis; resolution of meiotic joint molecules as recombinants; synapsis
Research Articles on C16orf73
Similar Products
Product Notes
The C16orf73 meiob (Catalog #AAA1278351) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacagcaa ctgtaatctc aaaaaccatt attacaacta atccagatat accagaagct aacattctgc tgaattttat acgagaaaat aaagaaacaa atgttctgga tgatgaaatt gacagttatt tcaaagaatc cataaattta agtacaatag ttgatgtcta cacagttgaa caattaaagg gaaaagcttt gaagaatgaa ggaaaagctg atccttccta tggcatcctt tatgcctaca tttccacact caacattgat gatgaaacta caaaagtagt tcgaaataga tgttccagct gtggttatat tgtaaatgaa gcatctaaca tgtgcacaac ttgcaacaaa aactccttgg actttaaatc tgtctttctc agtttccatg tgctgattga tctgactgat cacacaggca cccttcattc ctgtagtctc acaggaagtg ttgctgagga gactttgggc tgcacgttcg ttctatcaca cagagcaagg agtggattga aaattagtgt actctcgtgc aagcttgcag atcctactga ggcaagcaga aacttgtctg gacaaaaaca tgtttaa. It is sometimes possible for the material contained within the vial of "C16orf73, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
