C16orf13 cdna clone
C16orf13 cDNA Clone
Gene Names
METTL26; JFP2; C16orf13
Synonyms
C16orf13; C16orf13 cDNA Clone; C16orf13 cdna clone
Sequence
atgctggtggcggcggccgcggagcggaacaaggatcccatcttgcacgtgctgcggcagtacctggatccggcccagcgtggcgtccgcgtcctcgaggtggcctcgggctccggccagcacgcagcgcacttcgcgcgggccttccccctggccgagtggcagccgtcggacgtggaccagcgctgcctggacaggaacccagaatgggggcttcgggacacagccctcctggaggacctgggaaaggccagtggcctgctcctggagaggatggtggacatgccagccaacaacaaatgcctgatcttccggaaaaactaa
Sequence Length
324
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
20,009 Da
NCBI Official Full Name
Homo sapiens chromosome 16 open reading frame 13, mRNA
NCBI Official Synonym Full Names
methyltransferase like 26
NCBI Official Symbol
METTL26
NCBI Official Synonym Symbols
JFP2; C16orf13
NCBI Protein Information
UPF0585 protein C16orf13
UniProt Protein Name
UPF0585 protein C16orf13
Protein Family
UniProt Gene Name
C16orf13
UniProt Entry Name
CP013_HUMAN
Uniprot Description
C16orf13: Belongs to the UPF0585 family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 16p13.3
Similar Products
Product Notes
The C16orf13 c16orf13 (Catalog #AAA1272832) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctggtgg cggcggccgc ggagcggaac aaggatccca tcttgcacgt gctgcggcag tacctggatc cggcccagcg tggcgtccgc gtcctcgagg tggcctcggg ctccggccag cacgcagcgc acttcgcgcg ggccttcccc ctggccgagt ggcagccgtc ggacgtggac cagcgctgcc tggacaggaa cccagaatgg gggcttcggg acacagccct cctggaggac ctgggaaagg ccagtggcct gctcctggag aggatggtgg acatgccagc caacaacaaa tgcctgatct tccggaaaaa ctaa. It is sometimes possible for the material contained within the vial of "C16orf13, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
