C14orf149 cdna clone
C14orf149 cDNA Clone
Gene Names
L3HYPDH; C14orf149
Synonyms
C14orf149; C14orf149 cDNA Clone; C14orf149 cdna clone
Sequence
atggagagcgcgctggcggtgccctggctgcccccgcatgatccagggacgccggtgctgtcggtggtggacatgcacacgggcggcgagcccttgcgtatcgtgctggcggggtgtccggaggtgtctgggcccaccctgctggccaagcggcgctacatgcgccagcaccttgaccacgtgcggcgacggctcatgttcgagccccgagggcaccgggacatgtacggggcggtcctagtcccgagcgagctgccggacgcgcatctgggcgtcctgttcctgcacaacgagggctacagctccatgtgcggccacgcagtgctggcgctgggccgcttcgctttggacttcgggcttgtgccggcgccccctgcgggcacccgcgaggcccgcgtcaatatccactgcccctgcgggctggtgaccgccttcgtggcatgcgaggacggccgcagccacggaccggtgcgcttccacagcgtcccggccttcgtgctggccacagatctcatggtggatgttcctggacatggaaaggtgatggtggacattgcatatggcggtgcattttatgcatttgttactgctgaaaagttaggactagacatttgttctgcaaagaccagggaccttgtggatgcagcgagtgcagtgacagaggcagtgaaagctcagtttaaaattaatcatcctgatagtgaagaccttgcctttttatatggaactatattaacagatggaaaagatgcttataccaaggaaccaaccaccaacatttgtgtttttgcagatgaacaggttgacagaagtcccactggctcaggagtgacagcccgaattgccttacagtatcacaaagggcttctggaactgaaccagatgagagccttcaaaagcagtgcaactggctcagtattcacagggaaagctgtgagggaagcgaaatgtggtgattttaaagctgttatagtggaagtatcaggacaagcccattacacgggtacagcaagctttataatagaagatgacgacccattgagggatggatttcttctcaagtga
Sequence Length
1065
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
38,138 Da
NCBI Official Full Name
Homo sapiens chromosome 14 open reading frame 149, mRNA
NCBI Official Synonym Full Names
trans-L-3-hydroxyproline dehydratase
NCBI Official Symbol
L3HYPDH
NCBI Official Synonym Symbols
C14orf149
NCBI Protein Information
trans-3-hydroxy-L-proline dehydratase
UniProt Protein Name
Trans-3-hydroxy-L-proline dehydratase
UniProt Gene Name
L3HYPDH
UniProt Synonym Gene Names
C14orf149
UniProt Entry Name
T3HPD_HUMAN
Uniprot Description
L3HYPDH: Catalyzes the dehydration of trans-3-hydroxy-L-proline to delta-1-pyrroline-2-carboxylate (Pyr2C). May be required to degrade trans-3-hydroxy-L-proline from the diet and originating from the degradation of proteins such as collagen-IV that contain it. Belongs to the proline racemase family.
Protein type: Isomerase; EC 4.2.1.77
Chromosomal Location of Human Ortholog: 14q23.1
Molecular Function: hydro-lyase activity; proline racemase activity
Biological Process: metabolic process
Research Articles on C14orf149
Similar Products
Product Notes
The C14orf149 l3hypdh (Catalog #AAA1271806) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagagcg cgctggcggt gccctggctg cccccgcatg atccagggac gccggtgctg tcggtggtgg acatgcacac gggcggcgag cccttgcgta tcgtgctggc ggggtgtccg gaggtgtctg ggcccaccct gctggccaag cggcgctaca tgcgccagca ccttgaccac gtgcggcgac ggctcatgtt cgagccccga gggcaccggg acatgtacgg ggcggtccta gtcccgagcg agctgccgga cgcgcatctg ggcgtcctgt tcctgcacaa cgagggctac agctccatgt gcggccacgc agtgctggcg ctgggccgct tcgctttgga cttcgggctt gtgccggcgc cccctgcggg cacccgcgag gcccgcgtca atatccactg cccctgcggg ctggtgaccg ccttcgtggc atgcgaggac ggccgcagcc acggaccggt gcgcttccac agcgtcccgg ccttcgtgct ggccacagat ctcatggtgg atgttcctgg acatggaaag gtgatggtgg acattgcata tggcggtgca ttttatgcat ttgttactgc tgaaaagtta ggactagaca tttgttctgc aaagaccagg gaccttgtgg atgcagcgag tgcagtgaca gaggcagtga aagctcagtt taaaattaat catcctgata gtgaagacct tgccttttta tatggaacta tattaacaga tggaaaagat gcttatacca aggaaccaac caccaacatt tgtgtttttg cagatgaaca ggttgacaga agtcccactg gctcaggagt gacagcccga attgccttac agtatcacaa agggcttctg gaactgaacc agatgagagc cttcaaaagc agtgcaactg gctcagtatt cacagggaaa gctgtgaggg aagcgaaatg tggtgatttt aaagctgtta tagtggaagt atcaggacaa gcccattaca cgggtacagc aagctttata atagaagatg acgacccatt gagggatgga tttcttctca agtga. It is sometimes possible for the material contained within the vial of "C14orf149, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
