Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

C14orf126 cdna clone

C14orf126 cDNA Clone

Gene Names
DTD2; C14orf126
Synonyms
C14orf126; C14orf126 cDNA Clone; C14orf126 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgagggtagccggattcctcaggcccgggcgctcctacagcagtgcctgcacgcccggctgcaaattcgcccagccgatggggacgtcgcggcccagtgggtggaggtccaaagaggactggtgatctacgtgtgctttttcaagggagctgataaagaacttcttcccaaaatggttaatacactgttaaatgtgaaattaagtgagacagaaaatggcaagcatgtctctatattggatctacctggcaacattcttattatccctcaagctacccttggaggaagactaaaaggaagaaacatgcaatatcactctaactctggaaaagaagaagggtttgaactttactctcaatttgtgactctatgtgaaaaagaagtagctgctaatagcaagtgtgctgaagctagggttgtagtggaacatggcacttatgggaacaggcaggtgttaaagctggacaccaacggaccattcacacacttaattgagttttga
Sequence Length
507
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,660 Da
NCBI Official Full Name
Homo sapiens chromosome 14 open reading frame 126, mRNA
NCBI Official Synonym Full Names
D-tyrosyl-tRNA deacylase 2 (putative)
NCBI Official Symbol
DTD2
NCBI Official Synonym Symbols
C14orf126
NCBI Protein Information
probable D-tyrosyl-tRNA(Tyr) deacylase 2
UniProt Protein Name
Probable D-tyrosyl-tRNA(Tyr) deacylase 2
UniProt Gene Name
DTD2
UniProt Synonym Gene Names
C14orf126
UniProt Entry Name
DTD2_HUMAN

Uniprot Description

DTD2: Hydrolyzes D-tyrosyl-tRNA(Tyr) into D-tyrosine and free tRNA(Tyr). Could be a defense mechanism against a harmful effect of D-tyrosine (Potential). Belongs to the DTD family.

Protein type: Hydrolase; EC 3.1.-.-

Chromosomal Location of Human Ortholog: 14q12

Cellular Component: cytoplasm

Molecular Function: D-tyrosyl-tRNA(Tyr) deacylase activity; protein binding

Biological Process: tRNA metabolic process

Similar Products

Product Notes

The C14orf126 dtd2 (Catalog #AAA1271726) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgagg gtagccggat tcctcaggcc cgggcgctcc tacagcagtg cctgcacgcc cggctgcaaa ttcgcccagc cgatggggac gtcgcggccc agtgggtgga ggtccaaaga ggactggtga tctacgtgtg ctttttcaag ggagctgata aagaacttct tcccaaaatg gttaatacac tgttaaatgt gaaattaagt gagacagaaa atggcaagca tgtctctata ttggatctac ctggcaacat tcttattatc cctcaagcta cccttggagg aagactaaaa ggaagaaaca tgcaatatca ctctaactct ggaaaagaag aagggtttga actttactct caatttgtga ctctatgtga aaaagaagta gctgctaata gcaagtgtgc tgaagctagg gttgtagtgg aacatggcac ttatgggaac aggcaggtgt taaagctgga caccaacgga ccattcacac acttaattga gttttga. It is sometimes possible for the material contained within the vial of "C14orf126, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.