C13orf33 cdna clone

C13orf33 cDNA Clone

Gene Names

MEDAG; AWMS3; MEDA4; MEDA-4; hAWMS3; C13orf33

Synonyms

C13orf33; C13orf33 cDNA Clone; C13orf33 cdna clone

Ordering
Cat. Num. AAA1274075 For Research Use Only!

Sequence

atggcgggggcggcctgcgagccggtggccaggccgagcctgacctccatctcgtctggggagcttcgcagcctgtggacctgcgactgcgagctggccctgctgccgctggctcagctgctgcgcctgcagcccggtgccttccagctgagcggcgaccagctcgtggtggccgggcccggggagccggcggcggcgcgggggggcttcaacgtcttcggtgacggcctcgtgcgcctcgacgggcagctctaccgcctcagcagctacatcaagaggtatgtggaactgaccaactactgtgattataaagactacagggaaactatattgagcaaaccaatgttgttctttattaatgtacagaccaaaaaagacacctcaaaagaaaggacgtacgcgtttcttgtaaacacgaggcaccccaagataagaagacagatagagcaagggatggacatggtcatctcctcagtgattggagaaagttaccggcttcagtttgattttcaagaggcagtgaagaatttcttccccccaggaaatgaagtggttaatggagaaaatttaagctttgcatatgaattcaaagctgatgcattatttgatttcttctattggtttgggctcagtaattccgttgtaaaagtaaatggaaaagttctgaatttgtcaagtacaagtccagaaaagaaggagacgattaagttatttctggaaaaaatgagtgagcctttaatccgaaggagcagtttctctgaccgaaagttcagtgtaacttccagaggttcaatagatgatgtttttaactgcaatctgtcacccagatcatctctgacagagcctcttttggcagaattaccatttccaagtgttctggaatctgaagagacacccaaccaatttatctga

Sequence Length

912

Vector

Please Inquire

NCBI and Uniprot Product Information

NCBI GI #

25303978

NCBI GeneID

84935

Molecular Weight

17,194 Da

NCBI Official Full Name

Homo sapiens chromosome 13 open reading frame 33, mRNA

NCBI Official Synonym Full Names

mesenteric estrogen dependent adipogenesis

NCBI Official Symbol

MEDAG

NCBI Official Synonym Symbols

AWMS3; MEDA4; MEDA-4; hAWMS3; C13orf33

NCBI Protein Information

mesenteric estrogen-dependent adipogenesis protein

UniProt Protein Name

Mesenteric estrogen-dependent adipogenesis protein

UniProt Gene Name

MEDAG

UniProt Synonym Gene Names

AWMS3; C13orf33; MEDA4; hAWMS3; MEDA-4

UniProt Entry Name

MEDAG_HUMAN

Uniprot Description

MEDA-4: 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 13q12.3

Cellular Component: cytoplasm

Biological Process: positive regulation of fat cell differentiation

Research Articles on C13orf33

1. study identifies Meda-4 as a novel adipogenic gene, capable of promoting differentiation of preadipocytes into adipocytes, increasing lipid content and glucose uptake in adipocytes; it might play an important role in adipose tissue expansion in normal and aberrant hormonal conditions and pathophysiological states

Similar Products

Product Notes

The C13orf33 medag (Catalog #AAA1274075) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggggg cggcctgcga gccggtggcc aggccgagcc tgacctccat ctcgtctggg gagcttcgca gcctgtggac ctgcgactgc gagctggccc tgctgccgct ggctcagctg ctgcgcctgc agcccggtgc cttccagctg agcggcgacc agctcgtggt ggccgggccc ggggagccgg cggcggcgcg ggggggcttc aacgtcttcg gtgacggcct cgtgcgcctc gacgggcagc tctaccgcct cagcagctac atcaagaggt atgtggaact gaccaactac tgtgattata aagactacag ggaaactata ttgagcaaac caatgttgtt ctttattaat gtacagacca aaaaagacac ctcaaaagaa aggacgtacg cgtttcttgt aaacacgagg caccccaaga taagaagaca gatagagcaa gggatggaca tggtcatctc ctcagtgatt ggagaaagtt accggcttca gtttgatttt caagaggcag tgaagaattt cttcccccca ggaaatgaag tggttaatgg agaaaattta agctttgcat atgaattcaa agctgatgca ttatttgatt tcttctattg gtttgggctc agtaattccg ttgtaaaagt aaatggaaaa gttctgaatt tgtcaagtac aagtccagaa aagaaggaga cgattaagtt atttctggaa aaaatgagtg agcctttaat ccgaaggagc agtttctctg accgaaagtt cagtgtaact tccagaggtt caatagatga tgtttttaac tgcaatctgt cacccagatc atctctgaca gagcctcttt tggcagaatt accatttcca agtgttctgg aatctgaaga gacacccaac caatttatct ga. It is sometimes possible for the material contained within the vial of "C13orf33, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

C13orf33 cdna clone